ID: 1037981925

View in Genome Browser
Species Human (GRCh38)
Location 8:23260483-23260505
Sequence CAGGAAAATCTTGAAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 418}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037981925_1037981928 15 Left 1037981925 8:23260483-23260505 CCTTCATCTTCAAGATTTTCCTG 0: 1
1: 0
2: 2
3: 35
4: 418
Right 1037981928 8:23260521-23260543 ATTTCTTTGCCTTGCAGGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 300
1037981925_1037981927 10 Left 1037981925 8:23260483-23260505 CCTTCATCTTCAAGATTTTCCTG 0: 1
1: 0
2: 2
3: 35
4: 418
Right 1037981927 8:23260516-23260538 CAGTCATTTCTTTGCCTTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037981925 Original CRISPR CAGGAAAATCTTGAAGATGA AGG (reversed) Intronic
901455169 1:9358997-9359019 TTGGAAAATCCTGAAGATGTTGG + Intronic
901911207 1:12459800-12459822 CGGGGAAAGTTTGAAGATGATGG - Intronic
904487514 1:30836975-30836997 AAAGAAAATTTTCAAGATGAAGG - Intergenic
904636136 1:31883066-31883088 GAGGAAACTCTTGGAGATGATGG + Intergenic
906208764 1:44000755-44000777 CAGGGAACTCACGAAGATGATGG + Exonic
906265950 1:44429632-44429654 GAGGGAAAACTTGAAGATGGAGG + Intronic
906821058 1:48930416-48930438 CAACAAAAACTTAAAGATGAGGG - Intronic
906941204 1:50257004-50257026 CAGGCAAATCTAGAAGTTTACGG + Intergenic
907070139 1:51527091-51527113 CAGGACAATGGTTAAGATGATGG + Intergenic
907858913 1:58331864-58331886 CAGGAATACCTTGGAGATGTTGG - Intronic
907858973 1:58332395-58332417 CAGGAATACCTTGGAGATGTTGG + Intronic
909460820 1:75911440-75911462 CAAGAAAAGCTTGAATAGGATGG - Intronic
909899666 1:81116631-81116653 CAGGAAACTTTTGAGAATGATGG - Intergenic
912549403 1:110475240-110475262 GAGCAGAATCTTGAAGAAGATGG + Intergenic
912830829 1:112952366-112952388 GAGGAAAATAATTAAGATGAGGG + Intronic
913073191 1:115319244-115319266 ATGGAGAATCTTGAAGAAGAAGG - Intronic
913751228 1:121969586-121969608 CAGAAAATTCTTTACGATGATGG + Intergenic
913763402 1:122160874-122160896 CAGAAAATTCTTTACGATGATGG + Intergenic
914811474 1:151031851-151031873 GAGTAAAATCATGCAGATGATGG - Intronic
915782316 1:158566438-158566460 TGGGAAAAACTTGAAAATGATGG + Intergenic
916294621 1:163203794-163203816 CAGGAAAAGTTTGAAGGAGAAGG - Intronic
916879483 1:169005920-169005942 AAGGCAGATCTTGAAGAAGAGGG + Intergenic
917234482 1:172875923-172875945 AAGGAAACTTTTGGAGATGATGG - Intergenic
917813356 1:178682445-178682467 GAGCAAAGACTTGAAGATGAAGG - Intergenic
918924156 1:190758780-190758802 AAGGTAAATATTGAAGTTGATGG - Intergenic
919366348 1:196666109-196666131 CAGGATAATTTTGCTGATGAAGG + Intronic
919984647 1:202664497-202664519 AAGGAAATGCTTGAAGGTGATGG - Intronic
920502885 1:206496584-206496606 CATGAAACGCTTGAAGAGGAAGG - Exonic
920935746 1:210432789-210432811 CACCAAAACCTTGAAGCTGAAGG - Intronic
921480991 1:215664679-215664701 AAGGCTAATCTTGAATATGATGG + Intronic
921827047 1:219684165-219684187 CAGGTAAATATTTAAGGTGATGG - Intergenic
923941304 1:238830666-238830688 CAGGAAAATATTGAATAGTAGGG - Intergenic
924011288 1:239667749-239667771 CAGGAAAACTTTCAAGATAAGGG - Intronic
924274738 1:242374379-242374401 CAAGAAAACCTTGGTGATGAAGG - Intronic
924675960 1:246178264-246178286 CATCAAATTCTTGAAGGTGATGG - Intronic
924954105 1:248910979-248911001 GAGGAAACTCTTGGAGATGATGG - Intronic
1063039822 10:2325734-2325756 CATGAAAATCATGAAGAATATGG - Intergenic
1063051702 10:2456649-2456671 GAAGCAAATATTGAAGATGAAGG - Intergenic
1064162203 10:12956345-12956367 CAGGAAAATGGTCTAGATGAAGG + Intronic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1064708964 10:18103489-18103511 CAAGAAAACCTTGAAGAGGAGGG + Intergenic
1064931881 10:20637586-20637608 AAGGAAAATATTCAAGATGGAGG + Intergenic
1066138650 10:32479738-32479760 TTCGAAAATCTTGAAGAGGAAGG - Intronic
1067268551 10:44769658-44769680 CAGGAAAATCATGCAGGTCAAGG - Intergenic
1068039090 10:51800208-51800230 CAAGAGATTCTTGAACATGAGGG - Intronic
1068550911 10:58406815-58406837 GAGGAAACTCTTAGAGATGATGG + Intergenic
1068863908 10:61874785-61874807 CAGGAAAAACTTCATGATGTTGG + Intergenic
1069275036 10:66579691-66579713 CAAGAAATTCTCGGAGATGAAGG - Intronic
1070071105 10:73090436-73090458 GAGGATACTCTTGAAGGTGATGG + Intronic
1070357755 10:75657311-75657333 CAGAAAGATCTTAAAGATGGTGG + Intronic
1070607497 10:77909228-77909250 CATGAGAAGCCTGAAGATGAGGG + Intronic
1072192528 10:93087862-93087884 AAGGAAAATCATTACGATGATGG + Intergenic
1073197382 10:101703557-101703579 AAAAAAAAACTTGAAGATGAAGG + Intergenic
1073615873 10:104994555-104994577 AAGGAAACTTTTGAAGGTGACGG - Intronic
1073927876 10:108538104-108538126 CAGGAAAATCTTGGCTGTGATGG + Intergenic
1074120016 10:110487261-110487283 AAGGAAAATCTTCAAAATGCGGG - Intergenic
1075621537 10:123931525-123931547 GAGGATGATCTTGCAGATGATGG + Intronic
1075755927 10:124811302-124811324 AAGCATAATCTGGAAGATGAAGG + Intronic
1076535791 10:131175921-131175943 CAGGAAAATGTTTTAAATGATGG - Intronic
1076863492 10:133155115-133155137 CAGGACTTTCTTGAAGAAGAAGG + Intergenic
1078387639 11:10906890-10906912 CAGAAAAATGTTAAGGATGATGG - Intergenic
1078677726 11:13440039-13440061 CAGAGGAATCTTGAAGATGATGG - Intronic
1079466277 11:20734156-20734178 GAGGAAAATGTAGAAGATCATGG + Intronic
1080443878 11:32319414-32319436 AAGGAAAATCTGGAAGACAAGGG - Intergenic
1081216435 11:40404907-40404929 TAGGAAACTATTTAAGATGATGG - Intronic
1081409782 11:42744164-42744186 AAGGAAACTTTTGAAGGTGATGG + Intergenic
1082090566 11:48085998-48086020 CATGAAAATGTTAGAGATGAAGG - Intronic
1083004117 11:59325219-59325241 AAAGTAAATCTTGAAGATGCTGG - Intergenic
1083588267 11:63876241-63876263 CAGGAGAGTCCTGAAGTTGAAGG - Intronic
1085228550 11:74944928-74944950 CTGGAAAATGTTAAATATGATGG + Intronic
1085942275 11:81219383-81219405 CAGGAAAATTTATCAGATGAAGG + Intergenic
1085956022 11:81396025-81396047 AAGGAAAATCTGAAAGCTGAAGG + Intergenic
1087594041 11:100231583-100231605 CAGGACAATTTTGAGGATAAAGG - Intronic
1087854790 11:103078771-103078793 CAGGAAAATGTTTCAGAAGAGGG - Intronic
1089032858 11:115351259-115351281 CAGAAAGATATTGAAGAAGAAGG - Intronic
1089777231 11:120846866-120846888 CTGGAAAACCGTGAAGAGGAGGG - Intronic
1090143091 11:124287003-124287025 AAGGAAAATAATGAAGTTGAAGG - Intergenic
1090797214 11:130145550-130145572 CAGGAAAGCCCTGAAGAAGAGGG + Intergenic
1090949517 11:131461078-131461100 AAGGGAAATTGTGAAGATGAGGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1092647667 12:10594631-10594653 GAGGAAACTTTTGGAGATGATGG + Intergenic
1093115278 12:15202227-15202249 AAGGAAACTTTTGAAGGTGATGG - Intronic
1093157837 12:15709379-15709401 GAGGTAAATTTTGAATATGAGGG + Intronic
1093228108 12:16510179-16510201 CAGGAAATTCTGGAAGACCAAGG - Intronic
1093415976 12:18921544-18921566 TAAGAAAATCTTGAAAAAGAAGG - Intergenic
1095099793 12:38168558-38168580 CAGGAAAACTATGAAGATCACGG + Intergenic
1095257362 12:40053895-40053917 GTGGAAAACCTTGAACATGAAGG + Intronic
1095574193 12:43716007-43716029 CAGGAAGATCTTGATTAGGAGGG + Intergenic
1095906209 12:47380683-47380705 CAGGTAAATCTTGGAGAGAACGG + Intergenic
1096026853 12:48373410-48373432 GAGGAAACTTTTGGAGATGATGG + Intergenic
1096095559 12:48933264-48933286 AAAGAAAAACTTGAAGAGGAAGG + Intronic
1096848936 12:54423155-54423177 TAGGAAAATTATGAAGCTGAAGG + Intergenic
1096991050 12:55803628-55803650 CAGGCATATCTTGAAGAACATGG - Exonic
1097083057 12:56447433-56447455 CAGAGAAGTCTGGAAGATGAGGG + Intronic
1098045446 12:66396051-66396073 CAGGATATTGTTGATGATGAGGG - Intronic
1098487274 12:71035979-71036001 CAAGAAAAACTTTAAAATGATGG + Intergenic
1098955361 12:76684041-76684063 CAGGCAGATCTTGTAAATGAGGG - Intergenic
1099405304 12:82252618-82252640 CAGGTAAATATAGAAGGTGATGG - Intronic
1099519919 12:83648095-83648117 CATGAAGATGATGAAGATGAAGG + Intergenic
1099830835 12:87840366-87840388 CAGTAATATCTGGAAAATGAAGG + Intergenic
1100647829 12:96550188-96550210 GATGAAAATCATAAAGATGATGG + Intronic
1100802803 12:98251149-98251171 CAGTCAAATCTTTAAAATGAGGG + Intergenic
1101391736 12:104307103-104307125 CAGTAAAATGATGAGGATGATGG + Intronic
1101416545 12:104513506-104513528 AACGAGAATCTTAAAGATGAAGG - Intronic
1102203018 12:111070452-111070474 AAAGAAAATCTTGAAAAAGAAGG - Intronic
1105745115 13:23370399-23370421 GAGGAAACTTTTGGAGATGATGG - Intronic
1107115565 13:36742292-36742314 CAGGAAAAATTAGAAAATGATGG - Intergenic
1109860013 13:68185262-68185284 CAAGAAAATCTTTAATGTGAAGG + Intergenic
1110681607 13:78320088-78320110 GAGGTAAAGCTTGAAGTTGAAGG - Intergenic
1110834470 13:80067629-80067651 CAGTAAAATATTGAGGATAAGGG - Intergenic
1111553388 13:89847154-89847176 AAGGAAAACGTTGAAGATGTAGG - Intergenic
1111703821 13:91723275-91723297 AAGGAAAATCTTTCAGATGCAGG - Intronic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1112712375 13:102144302-102144324 AAGGAAAATCATGGAGAAGATGG - Intronic
1112746957 13:102537194-102537216 AAGCAAAATCATGAAAATGAAGG - Intergenic
1113093957 13:106643905-106643927 CAGTAAAAATCTGAAGATGAGGG + Intergenic
1114617605 14:24076536-24076558 CCGGAAAATCCTGAATGTGAAGG + Exonic
1115304053 14:31915690-31915712 GAGGAAAAGGTTGAAGATGCTGG - Intergenic
1116553892 14:46278560-46278582 GAGGAACATTTTGAAGGTGATGG - Intergenic
1116803601 14:49468759-49468781 CAGGAAAGGCTTAAAGATTAGGG - Intergenic
1117397619 14:55326469-55326491 AAGGAAAATCTCTAAGATGTAGG - Intronic
1117761825 14:59037263-59037285 CAGGAAAATCTGGATGCAGAAGG + Intergenic
1118029605 14:61807559-61807581 CCTGGAAACCTTGAAGATGAAGG - Intergenic
1118852558 14:69595294-69595316 AAGGAAAAAGTTGAAGTTGAAGG + Intergenic
1118875174 14:69778397-69778419 CTGGAAAATCATGTAGAGGAGGG + Exonic
1119822112 14:77625827-77625849 CAGGAATCTTTTGAGGATGATGG - Intergenic
1120327272 14:83047037-83047059 CATGAAAATCTGTAAGTTGAAGG + Intergenic
1122025981 14:98876532-98876554 CAGAACAATCTTGAAAAAGAAGG + Intergenic
1124052296 15:26208539-26208561 ATTGAAAATCTTAAAGATGATGG + Intergenic
1124134092 15:27018988-27019010 CACGATAATCATGATGATGATGG + Intronic
1124336060 15:28857974-28857996 GATGAAACTCTTCAAGATGATGG - Intergenic
1124558724 15:30751019-30751041 CATGAAAAGCTGGAGGATGAAGG - Intronic
1124601859 15:31139774-31139796 CAGGAAAATCATTGAGATGATGG + Intronic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1125248390 15:37670561-37670583 AAGGTAAATCTTCAATATGATGG - Intergenic
1125784791 15:42306543-42306565 CAGGAAAATCAAGAAGATCTGGG + Exonic
1125830141 15:42709699-42709721 CAAAAAAATATTGGAGATGATGG + Intronic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126398963 15:48249596-48249618 CAGGAAAAAGTTGGAGATGATGG - Exonic
1126535644 15:49760108-49760130 CAGGGAAATCATGAAGAAAATGG + Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1131510243 15:93045679-93045701 CTGGAAGTTCTTGAAGATGATGG + Exonic
1131856768 15:96605629-96605651 CAGGAGGAGCTGGAAGATGACGG + Intergenic
1132168702 15:99624264-99624286 CAGCAAAAGCTTCAAGATGTTGG - Intronic
1133822173 16:9246554-9246576 CAGGAGAAGCTTAAAGATCAAGG - Intergenic
1135201248 16:20439441-20439463 TAGGAAAATCTGGAAGAAAATGG + Intronic
1135217859 16:20588423-20588445 TAGGAAAATCTGGAAGAAAATGG - Intergenic
1135384147 16:22021418-22021440 GAGGATATTCATGAAGATGAAGG - Intronic
1137014162 16:35357459-35357481 CAGGAAAATATAGAAGGGGACGG + Intergenic
1137827953 16:51515995-51516017 CCAGAAGATCTTGAAGATGAAGG - Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1140691090 16:77484546-77484568 CTGGAAAATCTGGGAGATGATGG - Intergenic
1141299925 16:82805026-82805048 AAGGAAAAGCATGAAGATAAGGG + Intronic
1141813066 16:86389437-86389459 CAGGTACTTCTTGAACATGATGG + Intergenic
1142418106 16:89954080-89954102 CAGGAAAAGGCTGAAGATCAAGG + Intronic
1143201064 17:5113883-5113905 CAGGAAAATCTTGTAAATGGTGG - Intronic
1143931521 17:10433373-10433395 AAGGAAATTCTTCAAGCTGATGG - Intergenic
1143940692 17:10538139-10538161 CTGGAAAATGTAGAAGATAATGG - Intronic
1144680593 17:17191216-17191238 CAGGAAAATTAAGAAAATGATGG + Exonic
1146474526 17:33152410-33152432 CAGGAAAAGCTTCAAGGTGGAGG + Intronic
1146741382 17:35286852-35286874 CAGGAAAATCCTGAAGAACTGGG - Intergenic
1147451475 17:40507525-40507547 CAGGAACATCTTTATTATGAAGG + Intergenic
1148003834 17:44408691-44408713 CTGTACAACCTTGAAGATGAAGG + Intronic
1149227650 17:54493667-54493689 TAGGAAAATCTAGAAGAAAATGG + Intergenic
1150343844 17:64389009-64389031 CAGGATAATTATGAAGATTATGG + Intronic
1150575691 17:66428802-66428824 CCTGAAAATCTTGAAGGAGAAGG + Intronic
1151530066 17:74698427-74698449 CAGCAATATGGTGAAGATGAGGG + Exonic
1151600082 17:75100703-75100725 CATGAGAACCTGGAAGATGAGGG - Exonic
1152315219 17:79576398-79576420 CATGAAAATCATGGAGAAGATGG + Intergenic
1152400051 17:80060577-80060599 CAAGAAAATTTTGAAAAGGAAGG + Intronic
1153267034 18:3281501-3281523 TAGAAAAATGATGAAGATGATGG + Intergenic
1153294618 18:3533869-3533891 CAGGATCATCTTGGAGAAGAGGG + Intronic
1153989508 18:10383985-10384007 CATGGATATCTTGAAGCTGATGG + Intergenic
1154232990 18:12575161-12575183 GAGGAAAAAGTTGAAGATGATGG + Intronic
1155023182 18:21915145-21915167 CAGGAAAATCCTAATGTTGAGGG + Intergenic
1156133868 18:34011990-34012012 CAGGAAAATGAAGAAGGTGAGGG - Intronic
1156256925 18:35407455-35407477 AAGCAAAATATTAAAGATGATGG + Intergenic
1156430641 18:37070113-37070135 CAGGAAAATCTTTAAGAACTTGG - Intronic
1156582036 18:38388573-38388595 CAGGAAAATCTGAAAGGAGAAGG - Intergenic
1156859180 18:41816545-41816567 CATGAGGGTCTTGAAGATGAGGG + Intergenic
1157032545 18:43929792-43929814 CAGAAAAATCTGCAAGCTGAAGG + Intergenic
1157060600 18:44284053-44284075 CAGGAGAATATTAAAGAAGATGG + Intergenic
1157701770 18:49765596-49765618 GAGGAAACTTTTGGAGATGATGG - Intergenic
1157947922 18:52002062-52002084 GAGGAAAGTCATGAAGATGTAGG - Intergenic
1158097029 18:53784602-53784624 CAGGAAAAGCTTAAAGGAGAAGG + Intergenic
1158245315 18:55425822-55425844 CAGGTAAATCTTAAACCTGAGGG + Intronic
1158366251 18:56740307-56740329 CAAGAAAATATAGAAAATGATGG - Intronic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1163076337 19:14895330-14895352 CAGGAAAATGTTTAAAATGTGGG + Intergenic
1163250496 19:16123890-16123912 CAGGAAAACCTGGAATAGGATGG + Intronic
1163650939 19:18517339-18517361 CAGGAGAATCTGGGAGATGGAGG - Intronic
1163803936 19:19385155-19385177 CAGGAGAATCTTGGAGATTCTGG - Intergenic
1164980447 19:32609695-32609717 CAGGAAACTCTTGCAAGTGAGGG + Intronic
1165661200 19:37581765-37581787 CAGGAGAATCTTTAAAATGGTGG - Intronic
1168159429 19:54499417-54499439 GAGGAAAATCTTGGATATGTTGG + Intronic
1168566230 19:57426266-57426288 AAGGAATATCTAGAATATGAGGG - Intronic
925119621 2:1407827-1407849 CAGTGTAATCTTGAAGATGTGGG - Intronic
925251136 2:2439781-2439803 AAGGTAACTATTGAAGATGACGG + Intergenic
927262764 2:21110485-21110507 CAGGACAATGTCAAAGATGAAGG - Intergenic
928153585 2:28855589-28855611 GAGGAAAATGATGAAGATTATGG + Intronic
928253003 2:29698208-29698230 CAAGCACATCTTGAAGATTAAGG - Intronic
931469659 2:62525875-62525897 CAGCCATATCTTGAGGATGAGGG - Intergenic
932409158 2:71535026-71535048 CAGCAAGATCTTGGAGAAGACGG + Exonic
932488309 2:72101057-72101079 GAGGAAAATGTTGAAGAGCAAGG - Intergenic
932719506 2:74128618-74128640 CAGAAAAATTTTGAAGATAGTGG - Intergenic
933247490 2:79992150-79992172 AAGGCAAACCTTGAAGGTGAGGG + Intronic
933538754 2:83611471-83611493 CAGTAATATTTAGAAGATGAAGG - Intergenic
933643482 2:84789153-84789175 CAAGACAGTGTTGAAGATGAAGG + Intronic
936642238 2:114327032-114327054 AAATAAAATTTTGAAGATGATGG - Intergenic
937610180 2:123851832-123851854 TGGGAAAATCTTGAAGAAGCAGG + Intergenic
937930041 2:127197476-127197498 AAGGAAAAGCTTTGAGATGATGG + Intronic
938924632 2:136027927-136027949 AAGGAAATTTTTGGAGATGATGG + Intergenic
939020525 2:136953014-136953036 CAGGAAAAAAATGAAGATTAGGG + Intronic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
940481577 2:154239893-154239915 CAATAAAATGTGGAAGATGAAGG - Intronic
940585618 2:155645016-155645038 CAGAAAGATCTTGAAGAGAAAGG + Intergenic
941766276 2:169300394-169300416 CAGGAGATTGGTGAAGATGAAGG + Intronic
942377397 2:175351915-175351937 CACCAAAAGCTGGAAGATGAAGG - Intergenic
942518387 2:176777192-176777214 CAGCACAATATTGGAGATGAGGG + Intergenic
943432365 2:187819893-187819915 CACAAAAATGTTGAAAATGAGGG + Intergenic
943444349 2:187965529-187965551 AAGATAAATCTTCAAGATGATGG + Intergenic
943696994 2:190947452-190947474 CTGGAAAATCTACAAGATGAAGG + Intronic
943848169 2:192678600-192678622 CAGGAAAATTTTAAAAATCATGG + Intergenic
944165601 2:196716645-196716667 AAGGAAACTTTTGGAGATGATGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944858546 2:203792042-203792064 CAGGAAGCTCTTGAAGGAGATGG + Intergenic
944879665 2:203999530-203999552 GAGGAAAAGCTTGAAAAGGAAGG + Intergenic
946387837 2:219396171-219396193 CAGGAATATCTTGATGGTGATGG + Intronic
946996854 2:225402530-225402552 CATGACAACCTGGAAGATGAGGG + Intronic
947356703 2:229303718-229303740 GAGGAAACTTTTGGAGATGATGG - Intergenic
1169627197 20:7584540-7584562 GAGGCAAATCTTTAACATGATGG - Intergenic
1169981091 20:11384662-11384684 CAGGAAACTTTTGAGTATGATGG + Intergenic
1170084972 20:12520101-12520123 CTGCAAAATCTTGAACAAGATGG + Intergenic
1170765434 20:19286014-19286036 AAGGAAAATATTTAAAATGATGG + Intronic
1171028874 20:21658023-21658045 CAGTAATATGTTGAAGAAGAGGG - Intergenic
1171779154 20:29403101-29403123 CAGGAAAACTGTGAAGATCAGGG - Intergenic
1171959204 20:31481803-31481825 CAGGACAGTTTTGAAGATGGAGG - Intronic
1172739453 20:37154281-37154303 CAGAAAAATCCAGAAGAGGACGG + Intronic
1173271152 20:41536185-41536207 AAGGAACAGGTTGAAGATGATGG + Intronic
1176017785 20:62945316-62945338 AAGGAAAAACTTGTAGGTGAAGG - Exonic
1177460574 21:21403447-21403469 ATGGAAAATCTTTAAGATTAAGG + Intronic
1178045382 21:28687788-28687810 CAGGAAAAGCTTAAGGATGGAGG + Intergenic
1181166196 22:20984426-20984448 AAGGACACTCTTGAGGATGAAGG - Intronic
1181415418 22:22755501-22755523 CAGAAAAAACTTGAAACTGAGGG - Intronic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1182030149 22:27152611-27152633 CAGGAAAATTTGGTTGATGATGG - Intergenic
1182207131 22:28640004-28640026 CAGAAAAATCCTCAAAATGATGG + Intronic
1182705156 22:32272351-32272373 CAGGAAAATCTTCTGGCTGATGG - Intergenic
1182799411 22:33019189-33019211 AAGGAAAACCTTGAAGAAGATGG - Intronic
1182986466 22:34722606-34722628 CAGGAAACTGTGGAGGATGAAGG - Intergenic
1183112346 22:35659646-35659668 CAAGTACATCTTGGAGATGAGGG + Exonic
949174698 3:1045794-1045816 CAGGGAATTCTTGAATATAAGGG + Intergenic
949780397 3:7680336-7680358 CAGGAAGCTCTAGAAGATGTGGG + Intronic
954526502 3:51276443-51276465 CAGTAAAAACTTGGAGGTGACGG + Intronic
954718511 3:52539442-52539464 CTGGAAGATGTTGAAGGTGAAGG + Intronic
954860396 3:53683557-53683579 CAGGAAAATATTCACGATCAAGG + Intronic
955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG + Intergenic
955830449 3:62996074-62996096 CAGGAAAATTTTTTAAATGAGGG - Intergenic
955919335 3:63939070-63939092 GGGGAGAATCTTCAAGATGATGG + Intronic
957085990 3:75677565-75677587 CAGGAAAACTGTGAAGATCAGGG + Intergenic
959342124 3:105144959-105144981 CAGGAAAATCTTAAATAATAAGG - Intergenic
960052816 3:113254069-113254091 CAGGAATATTTTTAAAATGAAGG - Intronic
960569565 3:119172558-119172580 CAGGAAACTCTGGAGGAAGATGG - Intronic
960675613 3:120191977-120191999 AAGGAAGCTTTTGAAGATGAGGG + Intronic
960705115 3:120474198-120474220 CTGTAAAATCTTGAGGATGTGGG + Intergenic
962057792 3:131891131-131891153 AAGGAAACTTCTGAAGATGATGG + Intronic
962071584 3:132038897-132038919 CAAGAAAAGCTGGAAAATGAAGG - Intronic
962150027 3:132882794-132882816 CAGGAGAAACTTGAAGGAGAGGG + Intergenic
962830232 3:139133003-139133025 CAGGAGAATCTGGAAGTTCAAGG - Intronic
962989111 3:140562583-140562605 CAGAAACATCTGGAAGATTAAGG + Intronic
963497900 3:146091893-146091915 CAGGAGAATCTTGTAAATGAAGG + Exonic
964087980 3:152840619-152840641 AAGGAAAATCTTTAAGGAGATGG + Intergenic
965328751 3:167342824-167342846 CAGGAAACTTTTGGAGGTGATGG + Intronic
965442968 3:168738953-168738975 CAGGAAAATTTACAAGAGGAAGG + Intergenic
966476547 3:180354927-180354949 GAGGAAAATCTTTAATATCATGG - Intergenic
966604684 3:181810420-181810442 CAGACAAATCCTGAATATGAGGG - Intergenic
966906667 3:184531108-184531130 CAAAAAGATCTTGAAGATGGTGG + Intronic
968712882 4:2132833-2132855 CAGGAAATTCTTCAGGCTGAAGG + Intronic
970081639 4:12293852-12293874 CAGGAAATTCTTGGAAATGCTGG - Intergenic
970326826 4:14934485-14934507 CATGAAAATAATGAGGATGAAGG - Intergenic
970346862 4:15160611-15160633 TAGGAAGAGCTGGAAGATGAGGG - Intergenic
973230413 4:47834646-47834668 AAGGGAACTTTTGAAGATGATGG + Intronic
973813590 4:54597522-54597544 CAGGAAAATGTTGGAGATGATGG - Intergenic
973820055 4:54655141-54655163 CAGGAAAGTATTGAGGATAAAGG + Intergenic
974019390 4:56679380-56679402 CAGGAAACTTTTGAGGGTGATGG - Intronic
974050032 4:56931865-56931887 CAGGAAATTGATGAAGATGAAGG + Exonic
974475983 4:62380918-62380940 CAGGAAAATCTGGAGAAAGAAGG + Intergenic
974509017 4:62812968-62812990 TAGGAGAATTTTGAAGAAGAAGG - Intergenic
974783049 4:66579472-66579494 CATGAAAATTTTGAAGACTATGG - Intergenic
975689993 4:76953432-76953454 TAGGCAATTCTTAAAGATGAGGG + Intronic
975894096 4:79065590-79065612 AAACAAAATCTTGCAGATGAGGG + Intergenic
977840675 4:101699856-101699878 CTGGAGAATATTGAAGAAGAAGG - Intronic
978912959 4:114086757-114086779 CAGGAAATTTTTGAAAAGGATGG + Intergenic
980098177 4:128514798-128514820 CTGGAAAATATGGAAGATTAAGG - Intergenic
980544495 4:134240992-134241014 CTAGAAAATCTTGAAAATAAGGG + Intergenic
980788277 4:137582740-137582762 AAGCAAAATGTTGAAGTTGAAGG + Intergenic
980958796 4:139454287-139454309 CACGATTATCTTGAAGATGCGGG - Exonic
982276811 4:153644393-153644415 AAGGAAAAACTTATAGATGAAGG - Intergenic
982476185 4:155854226-155854248 CAGTAATTTCTTGAAGATGGAGG + Exonic
982944509 4:161602905-161602927 CAGGAAACTCTTCAGGAAGAAGG + Intronic
984593315 4:181640107-181640129 CAGGGACATCAAGAAGATGAAGG + Intergenic
985681603 5:1258612-1258634 CAGGAGGATCTTGTAGATGTTGG + Exonic
987635858 5:20540334-20540356 CAGAAAAATCTTGAAGAACTTGG + Intronic
987704957 5:21451080-21451102 CTGAAAAATCTTGAAATTGATGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988604227 5:32666356-32666378 CAGGTAATTCTGGAAGTTGAAGG - Intergenic
989011161 5:36875333-36875355 GAGCAAAATCCTGAAGGTGAAGG + Intergenic
989540448 5:42611807-42611829 TGGCAATATCTTGAAGATGATGG - Intronic
990111175 5:52327275-52327297 CATAATAAACTTGAAGATGAGGG + Intergenic
990717032 5:58648925-58648947 CAGGGAAATCTTGAAGCTACAGG - Intronic
990856590 5:60274152-60274174 CAGGCAAATATTGATGATGGGGG + Intronic
991006087 5:61829326-61829348 GAGGAAAATTCTGAAAATGATGG + Intergenic
991699010 5:69299809-69299831 CAGGACATTCTTGGACATGAGGG - Intronic
992376171 5:76189792-76189814 GAGAAAAATCATTAAGATGAAGG - Intronic
992739229 5:79756337-79756359 CAGGAAGCTCCTGAAGATGAGGG - Intronic
992843742 5:80723215-80723237 CAAGACAATCTTGAAGAGCAAGG + Intronic
993319000 5:86449008-86449030 GAGGAAATTGTTGAAGATGAGGG + Intergenic
994133638 5:96260630-96260652 CAGGAAAAGCAAGAACATGATGG - Intergenic
994961580 5:106611419-106611441 CAGGAAAAAATGGAATATGATGG - Intergenic
997768142 5:136525818-136525840 CAGGAGAAGCTTTGAGATGAAGG - Intergenic
998373557 5:141676619-141676641 GAGGAAAATGTAGAAGAAGAAGG - Intronic
998882734 5:146660098-146660120 CATGAAAATCTTGAACAATATGG + Intronic
999144721 5:149384845-149384867 CAGGAGATTCTAGAAGAGGAAGG + Intronic
999549071 5:152664119-152664141 AAGGAAATTCTTTAAGCTGAAGG + Intergenic
1000151587 5:158507092-158507114 CAGGAAATTCTTCAGGCTGAAGG + Intergenic
1000688373 5:164282794-164282816 CAGAAATATCTTGAAGATATAGG + Intergenic
1001427384 5:171632132-171632154 GAGGGAAATCATGATGATGATGG - Intergenic
1001816064 5:174670532-174670554 CAGGAAAATCCTGACTATGCAGG + Intergenic
1003225016 6:4196175-4196197 GATGAGAATGTTGAAGATGAAGG + Intergenic
1003247142 6:4392587-4392609 CAGGAAAATATTGAAAAAAAAGG - Intergenic
1007654817 6:43445687-43445709 CAGGAGGATGTTGAGGATGAAGG - Exonic
1008557721 6:52690968-52690990 AAGGAAAAGGTAGAAGATGAAGG + Intergenic
1008934783 6:56978489-56978511 CAAAACAATCTTGAAGAAGAAGG - Intronic
1009678682 6:66862089-66862111 AAGGAAATTTTTGGAGATGATGG - Intergenic
1010018362 6:71130635-71130657 CAGTATATTCTTGAACATGAGGG - Intergenic
1010314755 6:74434895-74434917 CAGGAAGATATGGAAAATGAAGG - Intergenic
1010734724 6:79431154-79431176 CAGGAACAGCTTGAGGCTGAGGG - Intergenic
1010739778 6:79487131-79487153 CAAGAACATGATGAAGATGAAGG - Exonic
1011747828 6:90423740-90423762 CAGGAAGCTTTTGAAGATGATGG - Intergenic
1012178412 6:96119888-96119910 GAGGAACTTCTTGAATATGAGGG + Intronic
1013585519 6:111575231-111575253 AAGGAAAATCTTCGAGATTAGGG + Intronic
1014206075 6:118656734-118656756 AAAGAAAATTTTTAAGATGATGG - Intronic
1014305068 6:119730007-119730029 CAGGAAAACCATGAAAAGGAAGG - Intergenic
1014544645 6:122719551-122719573 CAGGAAAATTAGGAAAATGATGG + Intronic
1014549830 6:122777971-122777993 CTGGGATATCTTGAAGCTGAGGG - Intergenic
1014618941 6:123641593-123641615 CAGGAAAAACTTTAAGAGAAAGG + Intergenic
1017928390 6:158930382-158930404 CAGAAAACTCTTGAGGGTGATGG + Intergenic
1018157999 6:161007316-161007338 GAGGAATGTCTTGAAGAGGAGGG + Intronic
1018897417 6:168029940-168029962 CAGGACACACTTGAAAATGAAGG + Intronic
1020391716 7:7665633-7665655 CAGGAAACTCTTGGAAGTGATGG - Intronic
1020406140 7:7837209-7837231 CAGCAAAAATTTGAAGATTAAGG + Intronic
1020971405 7:14945931-14945953 AAGGAAAATCTTGAATTTCAAGG + Intronic
1021175424 7:17444376-17444398 CAGGAAAACCTTCAGGAAGATGG - Intergenic
1021645657 7:22787038-22787060 TAGGAAAATATTTCAGATGAGGG - Intergenic
1022071885 7:26923884-26923906 CAGGAAAATGATGAAGAAGCTGG + Intronic
1022857248 7:34327284-34327306 GAGGAAATTCTTTGAGATGATGG - Intergenic
1022877480 7:34550322-34550344 AAGGAAAATCTTAAAATTGATGG + Intergenic
1022925409 7:35051576-35051598 CAGAAAGAGCGTGAAGATGATGG + Intergenic
1023290963 7:38668609-38668631 CTAGAAAATCTAGAAGAAGATGG - Intergenic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1026461251 7:70617128-70617150 CAAGAAAGTCTTGAAGACAATGG - Intronic
1027573138 7:79897071-79897093 CAGGAAAAACTTAAACATCAAGG - Intergenic
1027785260 7:82572574-82572596 CAGGAGAATATTGGAGATGAAGG + Intergenic
1027960016 7:84933512-84933534 CAGGAAAATATAGAAGGTGGAGG + Intergenic
1027976214 7:85159240-85159262 AATGAAAAATTTGAAGATGATGG - Intronic
1029610068 7:101622121-101622143 CAGGAACACCGTGAAGTTGATGG + Exonic
1030281302 7:107778243-107778265 CAGGACAATGGTGAAGATGAAGG + Exonic
1030714085 7:112788853-112788875 CAGGGAAATGTTCAACATGATGG - Intronic
1032918076 7:136513755-136513777 GAGGAAACTTTTGAAGGTGATGG - Intergenic
1033352875 7:140576369-140576391 CAAGAAAATCTGGAAGAAAATGG - Intronic
1033664297 7:143426047-143426069 CAGAAAAATCATGAAGTTGATGG - Intergenic
1033933873 7:146558539-146558561 AAGGAAACTTTTGAAGTTGATGG - Intronic
1034328262 7:150257919-150257941 CAACAACATCATGAAGATGATGG + Intronic
1034764954 7:153711545-153711567 CAACAACATCATGAAGATGATGG - Intergenic
1035095322 7:156349580-156349602 CAAGATAATCGTGAAGATCATGG + Intergenic
1035284661 7:157798639-157798661 CAGGAGAATTATTAAGATGAAGG - Intronic
1037223623 8:16555471-16555493 CAGGAACACATTGAAAATGAAGG + Intronic
1037947935 8:23000799-23000821 GAGGAAAATCCTGAAAATGAAGG - Intronic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1038056032 8:23858523-23858545 AAGGAAAATGAGGAAGATGAGGG + Intergenic
1038906397 8:31908545-31908567 AAGGAAAATTTTGGAGGTGATGG - Intronic
1038912195 8:31977986-31978008 AAGGAAACTCATTAAGATGAGGG + Intronic
1038914845 8:32009636-32009658 GAGCAAAATCGTGAAGGTGAAGG + Intronic
1039365911 8:36927859-36927881 CAAGAAAATCTGCAAGTTGAAGG - Intronic
1039628970 8:39088075-39088097 CAGGAAGATGATGAGGATGAAGG - Intronic
1040686037 8:49874651-49874673 CAGGAATATCATGAATATGGTGG + Intergenic
1041190611 8:55350350-55350372 CAGGAAAATATTCTAGATTAAGG - Intronic
1041738049 8:61132314-61132336 CAGGGGAATCCTGGAGATGAGGG + Intronic
1042002694 8:64144228-64144250 AAGGCAAATATTTAAGATGATGG + Intergenic
1042220674 8:66470644-66470666 CAGGAGAATCCTGGAGATGAGGG + Intronic
1042756621 8:72221019-72221041 GAGGAAACTCTTGAATATGCAGG + Intergenic
1043094293 8:75946892-75946914 CAGAAAGCTCTTGAAGAAGATGG + Intergenic
1043969691 8:86515135-86515157 CAGAAGAATCTTGAAGCTGGAGG - Intronic
1044550062 8:93502066-93502088 GAGGAAAACCTTGAAGCTTAAGG - Intergenic
1045720155 8:105099863-105099885 CAGGGAGACCTTGAAGAAGAGGG + Intronic
1046044540 8:108948127-108948149 CAACAAAATCTTGGAGAAGAGGG + Intergenic
1046188154 8:110749923-110749945 AAGGAGACTTTTGAAGATGATGG + Intergenic
1050001486 9:1082090-1082112 GAGGAAAATCTTGGACGTGATGG + Intergenic
1050088908 9:1996076-1996098 CAGGCTAGTCTCGAAGATGATGG + Intergenic
1050336257 9:4592808-4592830 GAGGAAACTTTTGGAGATGATGG + Intronic
1050352834 9:4756583-4756605 CAGGAAACTCTTGAATTTCAAGG - Intergenic
1050602911 9:7270836-7270858 TTTGAAAATCTTGCAGATGATGG - Intergenic
1050641156 9:7668988-7669010 AAGGAAAAAGTTAAAGATGATGG - Intergenic
1051382863 9:16476430-16476452 GAGGAAAATGGTGATGATGAGGG - Intronic
1051596650 9:18830632-18830654 CACGAGAATCATGAAGATGCCGG + Intronic
1051646527 9:19274266-19274288 CAAGAAAATTTTGATGTTGATGG + Intronic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1052153368 9:25148974-25148996 AAGGAAATTCTTAAAGATTATGG - Intergenic
1052662471 9:31452294-31452316 AAGGAAACTTTTGAAGGTGATGG + Intergenic
1053093330 9:35300613-35300635 CAGGAAAATCTCCAATATGGTGG - Intronic
1053124922 9:35573296-35573318 GAGGAAACTTTTGGAGATGATGG + Intergenic
1054992060 9:71339770-71339792 CAGGAGAATTTTGGGGATGATGG + Intronic
1055198264 9:73624479-73624501 CAAGAAAATTTCAAAGATGAAGG + Intergenic
1055971420 9:81916157-81916179 CAGGAGAATTCTGAAGATGCAGG - Intergenic
1055973147 9:81931203-81931225 CAGGAGAATTCTGAAGATGCAGG - Intergenic
1055974900 9:81946295-81946317 CAGGAGAATTCTGAAGATGCAGG - Intergenic
1057186939 9:93062348-93062370 CATGTAAATCTTAAAGAAGAGGG - Intronic
1057315923 9:93968411-93968433 CAGCAAGAACATGAAGATGAAGG + Intergenic
1058726292 9:107807920-107807942 CTGGAAAATTTAAAAGATGAAGG + Intergenic
1059136032 9:111807341-111807363 CTGGAATGACTTGAAGATGAGGG - Intergenic
1059241244 9:112807699-112807721 CAGAAAAATCAAGAAGCTGAGGG - Intronic
1059847284 9:118294317-118294339 GGGCAAAATCTTGAAGGTGAGGG - Intergenic
1059907901 9:119008941-119008963 CCGGAAAATCTTTAAGATCTGGG - Intergenic
1060284904 9:122241881-122241903 CATGGAAATCTCGAAGATGATGG - Exonic
1061294074 9:129667504-129667526 GAGGAACAACTTGAAGGTGAAGG + Intronic
1061865750 9:133491050-133491072 GAGGAAAAGCTGGAGGATGAGGG + Intergenic
1062380780 9:136285598-136285620 CTGGAAAACCTTGGAGAAGAGGG + Exonic
1186319060 X:8404284-8404306 CTGGGAAATTTTCAAGATGAGGG + Intergenic
1186385776 X:9109074-9109096 CAGGAAAATTTTGGAGGTGATGG - Intronic
1187220151 X:17317876-17317898 GAGGAAACTTTTGAAGGTGATGG + Intergenic
1187498987 X:19823075-19823097 GGGGAAAATCTTGGAGAGGAGGG - Intronic
1189193546 X:39132748-39132770 GAGGAGAAACTTGAAGATGGAGG - Intergenic
1189265064 X:39708888-39708910 AAGTAATATCTTTAAGATGATGG + Intergenic
1189703361 X:43734581-43734603 CACGAAAACCTTGAAGATAGGGG + Intronic
1190586525 X:51949497-51949519 GAGGAAAATTTTGGAGGTGATGG - Intergenic
1191934529 X:66412109-66412131 CAGGAAAGTAATGAAGGTGATGG - Intergenic
1191959577 X:66685523-66685545 GAGGAAACTTTTGAAGGTGATGG + Intergenic
1194865949 X:99066997-99067019 CAAGAAAATTTTGGAGATGATGG + Intergenic
1196434030 X:115658808-115658830 CAGGAAAATATTGAACCAGAGGG - Intergenic
1196517917 X:116634942-116634964 GGGGAAAATCTTGAAGATATTGG + Intergenic
1196724245 X:118881725-118881747 CAGGAATATCTTGAAAAGCATGG - Intergenic
1197086754 X:122486222-122486244 CAAGAAAACTTTGAAGGTGATGG + Intergenic
1197789164 X:130233712-130233734 GAGGAAACTTTTGAAGGTGATGG + Intronic
1198130420 X:133688589-133688611 AAGGAAAATATTGATGTTGAGGG - Intronic
1198137571 X:133769424-133769446 GAGGAAACTCTTGGAGAAGATGG + Intronic
1198933446 X:141883152-141883174 CAGGAAACACTTGCAAATGATGG - Intronic
1198935450 X:141898825-141898847 CAGGAAAGCCTTGCAGATGTTGG - Intergenic
1198959569 X:142169984-142170006 CAGGAAACCCTTGCAGATGATGG + Intergenic
1198962918 X:142201838-142201860 CAGGAAACTCTTGCAGATGATGG + Intergenic
1199940690 X:152624511-152624533 AAGGAAACTTTTGGAGATGATGG + Intergenic
1199950583 X:152702827-152702849 CAGGAAACCCTTGCAGATGATGG - Intergenic
1199952854 X:152719082-152719104 CAGGAAACCCTTGCAGATGATGG - Intergenic
1199956829 X:152749366-152749388 CAGGAAACCCTTGCAGATGATGG + Intergenic
1199959099 X:152765634-152765656 CAGGAAACCCTTGCAGATGATGG + Intergenic
1200352000 X:155506976-155506998 CATGAATATATTGAAGATGTTGG - Exonic
1200950063 Y:8889383-8889405 CAAGAAACTCTAGAAGATGTAGG - Intergenic