ID: 1037983167

View in Genome Browser
Species Human (GRCh38)
Location 8:23269646-23269668
Sequence CAGAACCCACAGGTTCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037983159_1037983167 27 Left 1037983159 8:23269596-23269618 CCTAAGTAGAGAGCTATAGGAGT No data
Right 1037983167 8:23269646-23269668 CAGAACCCACAGGTTCCCGAAGG No data
1037983164_1037983167 -5 Left 1037983164 8:23269628-23269650 CCAGGTATACACTGGAGCCAGAA No data
Right 1037983167 8:23269646-23269668 CAGAACCCACAGGTTCCCGAAGG No data
1037983162_1037983167 2 Left 1037983162 8:23269621-23269643 CCAGTTCCCAGGTATACACTGGA No data
Right 1037983167 8:23269646-23269668 CAGAACCCACAGGTTCCCGAAGG No data
1037983163_1037983167 -4 Left 1037983163 8:23269627-23269649 CCCAGGTATACACTGGAGCCAGA No data
Right 1037983167 8:23269646-23269668 CAGAACCCACAGGTTCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037983167 Original CRISPR CAGAACCCACAGGTTCCCGA AGG Intergenic