ID: 1037983252

View in Genome Browser
Species Human (GRCh38)
Location 8:23270149-23270171
Sequence GTTAGTAAAGCCCAAGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037983252_1037983259 23 Left 1037983252 8:23270149-23270171 CCTATCTCTTGGGCTTTACTAAC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1037983259 8:23270195-23270217 GAGAACTCACAACGATACTGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1037983252_1037983260 24 Left 1037983252 8:23270149-23270171 CCTATCTCTTGGGCTTTACTAAC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1037983260 8:23270196-23270218 AGAACTCACAACGATACTGGGGG 0: 1
1: 0
2: 0
3: 5
4: 51
1037983252_1037983257 21 Left 1037983252 8:23270149-23270171 CCTATCTCTTGGGCTTTACTAAC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1037983257 8:23270193-23270215 CAGAGAACTCACAACGATACTGG 0: 1
1: 0
2: 1
3: 10
4: 80
1037983252_1037983258 22 Left 1037983252 8:23270149-23270171 CCTATCTCTTGGGCTTTACTAAC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1037983258 8:23270194-23270216 AGAGAACTCACAACGATACTGGG 0: 1
1: 0
2: 0
3: 17
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037983252 Original CRISPR GTTAGTAAAGCCCAAGAGAT AGG (reversed) Intronic