ID: 1037983254

View in Genome Browser
Species Human (GRCh38)
Location 8:23270171-23270193
Sequence GGATGAACTTCCAAGTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037983254_1037983259 1 Left 1037983254 8:23270171-23270193 CCCTTGTACTTGGAAGTTCATCC 0: 1
1: 1
2: 2
3: 4
4: 119
Right 1037983259 8:23270195-23270217 GAGAACTCACAACGATACTGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1037983254_1037983257 -1 Left 1037983254 8:23270171-23270193 CCCTTGTACTTGGAAGTTCATCC 0: 1
1: 1
2: 2
3: 4
4: 119
Right 1037983257 8:23270193-23270215 CAGAGAACTCACAACGATACTGG 0: 1
1: 0
2: 1
3: 10
4: 80
1037983254_1037983258 0 Left 1037983254 8:23270171-23270193 CCCTTGTACTTGGAAGTTCATCC 0: 1
1: 1
2: 2
3: 4
4: 119
Right 1037983258 8:23270194-23270216 AGAGAACTCACAACGATACTGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1037983254_1037983261 28 Left 1037983254 8:23270171-23270193 CCCTTGTACTTGGAAGTTCATCC 0: 1
1: 1
2: 2
3: 4
4: 119
Right 1037983261 8:23270222-23270244 CTCTCACATACTCACTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 163
1037983254_1037983260 2 Left 1037983254 8:23270171-23270193 CCCTTGTACTTGGAAGTTCATCC 0: 1
1: 1
2: 2
3: 4
4: 119
Right 1037983260 8:23270196-23270218 AGAACTCACAACGATACTGGGGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037983254 Original CRISPR GGATGAACTTCCAAGTACAA GGG (reversed) Intronic