ID: 1037983259

View in Genome Browser
Species Human (GRCh38)
Location 8:23270195-23270217
Sequence GAGAACTCACAACGATACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037983255_1037983259 0 Left 1037983255 8:23270172-23270194 CCTTGTACTTGGAAGTTCATCCA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1037983259 8:23270195-23270217 GAGAACTCACAACGATACTGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1037983252_1037983259 23 Left 1037983252 8:23270149-23270171 CCTATCTCTTGGGCTTTACTAAC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1037983259 8:23270195-23270217 GAGAACTCACAACGATACTGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1037983254_1037983259 1 Left 1037983254 8:23270171-23270193 CCCTTGTACTTGGAAGTTCATCC 0: 1
1: 1
2: 2
3: 4
4: 119
Right 1037983259 8:23270195-23270217 GAGAACTCACAACGATACTGGGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037983259 Original CRISPR GAGAACTCACAACGATACTG GGG Intronic