ID: 1037983259 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:23270195-23270217 |
Sequence | GAGAACTCACAACGATACTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 94 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 88} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037983255_1037983259 | 0 | Left | 1037983255 | 8:23270172-23270194 | CCTTGTACTTGGAAGTTCATCCA | 0: 1 1: 0 2: 0 3: 7 4: 108 |
||
Right | 1037983259 | 8:23270195-23270217 | GAGAACTCACAACGATACTGGGG | 0: 1 1: 0 2: 0 3: 5 4: 88 |
||||
1037983252_1037983259 | 23 | Left | 1037983252 | 8:23270149-23270171 | CCTATCTCTTGGGCTTTACTAAC | 0: 1 1: 0 2: 1 3: 10 4: 99 |
||
Right | 1037983259 | 8:23270195-23270217 | GAGAACTCACAACGATACTGGGG | 0: 1 1: 0 2: 0 3: 5 4: 88 |
||||
1037983254_1037983259 | 1 | Left | 1037983254 | 8:23270171-23270193 | CCCTTGTACTTGGAAGTTCATCC | 0: 1 1: 1 2: 2 3: 4 4: 119 |
||
Right | 1037983259 | 8:23270195-23270217 | GAGAACTCACAACGATACTGGGG | 0: 1 1: 0 2: 0 3: 5 4: 88 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037983259 | Original CRISPR | GAGAACTCACAACGATACTG GGG | Intronic | ||