ID: 1037983296

View in Genome Browser
Species Human (GRCh38)
Location 8:23270606-23270628
Sequence GGCCAGGTGGCACACGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037983291_1037983296 7 Left 1037983291 8:23270576-23270598 CCATCTCTACAAAAATTAAAAAA 0: 110
1: 2019
2: 22767
3: 258953
4: 259562
Right 1037983296 8:23270606-23270628 GGCCAGGTGGCACACGCCTGTGG No data
1037983288_1037983296 28 Left 1037983288 8:23270555-23270577 CCTAAGCAACATAGAAAGACCCC 0: 2
1: 60
2: 965
3: 7232
4: 29096
Right 1037983296 8:23270606-23270628 GGCCAGGTGGCACACGCCTGTGG No data
1037983290_1037983296 8 Left 1037983290 8:23270575-23270597 CCCATCTCTACAAAAATTAAAAA 0: 141
1: 2222
2: 18387
3: 144504
4: 310711
Right 1037983296 8:23270606-23270628 GGCCAGGTGGCACACGCCTGTGG No data
1037983289_1037983296 9 Left 1037983289 8:23270574-23270596 CCCCATCTCTACAAAAATTAAAA 0: 163
1: 2646
2: 16819
3: 130741
4: 230090
Right 1037983296 8:23270606-23270628 GGCCAGGTGGCACACGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037983296 Original CRISPR GGCCAGGTGGCACACGCCTG TGG Intronic
No off target data available for this crispr