ID: 1037985975

View in Genome Browser
Species Human (GRCh38)
Location 8:23290657-23290679
Sequence AGGGTCAAGCAGCTCCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037985975_1037985980 -3 Left 1037985975 8:23290657-23290679 CCATGTAGGAGCTGCTTGACCCT 0: 1
1: 0
2: 2
3: 5
4: 147
Right 1037985980 8:23290677-23290699 CCTGGGCAAGTTATTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037985975 Original CRISPR AGGGTCAAGCAGCTCCTACA TGG (reversed) Intronic
902107764 1:14052016-14052038 ACGGTGAAGCAGCTCATAAAGGG - Intergenic
904839131 1:33359941-33359963 AGGGATAAGCAGCCCCTAGAAGG - Intronic
908036922 1:60065474-60065496 AGGGTCTATCAGCTCTTAAAGGG - Intronic
911294891 1:96102911-96102933 AGATTCAATCATCTCCTACAAGG - Intergenic
913998129 1:143668020-143668042 AGGGTCCTGCAGCTCCTGGAAGG - Intergenic
915482453 1:156196277-156196299 AGGGGCAGGCTGCTCCTAAAAGG - Intronic
915931442 1:160062909-160062931 AGGCTGAAGAAGCTACTACAGGG + Intronic
918069899 1:181127083-181127105 AGGGTCAGGCAGCTCCCACAGGG - Intergenic
921313439 1:213868680-213868702 AGGGCCAACCAGCTCACACATGG + Intergenic
921841981 1:219838434-219838456 AGAGTCACTCAGCTCATACATGG + Intronic
922887485 1:229031290-229031312 AGGGTCAAGAAGGGCCTTCATGG + Intergenic
1065742505 10:28809931-28809953 AGGGTCAAAAATCTACTACAAGG + Intergenic
1065919975 10:30384775-30384797 TGGCTCAAGCAGCTGATACACGG - Intergenic
1067158679 10:43803990-43804012 AGGGGTGAGCTGCTCCTACAAGG + Intergenic
1068374213 10:56156450-56156472 AAGGAAAAGCAGATCCTACAAGG - Intergenic
1071782485 10:88861793-88861815 AGGGTCACACAGCTAATACATGG + Intergenic
1071816277 10:89235189-89235211 CTGGTCAGGCAGCTCCTCCAAGG + Intronic
1072101187 10:92230921-92230943 AGGGTCAGGCATGGCCTACAGGG + Intronic
1072631092 10:97146980-97147002 AGGCTCAAGCAACTGCTAAAAGG + Intronic
1073204652 10:101762492-101762514 GAGATCAGGCAGCTCCTACATGG + Intergenic
1075278328 10:121115685-121115707 AGGGTGAAGCAGCTACTATTGGG + Intergenic
1075614173 10:123879397-123879419 AGGGTTATGCAGCTTCTACGTGG - Intronic
1075908302 10:126102074-126102096 AGGGAAAAGCAACTCCTCCAGGG + Intronic
1076428385 10:130383525-130383547 AGAAGCAAGCAGCTCCTATATGG - Intergenic
1076513355 10:131027912-131027934 AGGGAAAGGCAGCTCCTTCATGG - Intergenic
1076513375 10:131027999-131028021 AGGGAAAGGCAGCTCCTTCATGG - Intergenic
1079394774 11:20052128-20052150 AGGGTGAAGCTGATGCTACAGGG - Intronic
1085544735 11:77306896-77306918 AGGGTTAAGTAGCTTCTCCAAGG + Intergenic
1087009450 11:93499560-93499582 AGGACCAAGCAGCCCCTGCATGG + Intronic
1087175968 11:95095778-95095800 AAGGTCAAACAGCTTCTAGATGG + Intronic
1091774054 12:3172786-3172808 AGGCTCAATCAACACCTACAGGG - Intronic
1098101834 12:67026056-67026078 AGAGTGAAGCAGCCCCGACAGGG - Intergenic
1098594313 12:72254341-72254363 AGGGTCAAGCAACTACAACCAGG - Intronic
1101565019 12:105896891-105896913 AGGCTCAACCTGGTCCTACAGGG - Intergenic
1103817732 12:123671928-123671950 AGTGTCAAGCAGCTTGTAAAGGG + Intronic
1104268699 12:127262620-127262642 AAGGTCAATCATCTCCTACTTGG + Intergenic
1107305712 13:39016373-39016395 AAGATCATGCAGCTACTACATGG + Intronic
1107365529 13:39669096-39669118 AGAGTCAACCATCTCCCACATGG - Intronic
1107552733 13:41492472-41492494 AAGGTCACCCAGCTACTACAAGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1111823894 13:93244638-93244660 AGGGTTAAGGAGCTCCCCCATGG + Intronic
1120853527 14:89192985-89193007 AGGGACAAGCAGTTCCTAAGGGG + Intronic
1121028930 14:90641251-90641273 AGGGACCAGCTGCTCCTCCAAGG + Intronic
1121088345 14:91163719-91163741 AGGGTCACACAGCTGCTGCACGG - Intronic
1121160314 14:91732773-91732795 AGGGTAAAGCAGGTTTTACATGG - Intronic
1121162635 14:91759395-91759417 AAAGTCAAGAAGCTCCTCCATGG - Intronic
1122575082 14:102737057-102737079 AGGGTCACTCAGCTCCTACACGG + Intergenic
1125439311 15:39684898-39684920 AGGGTCAAGTAACTTCTCCAAGG + Intronic
1128355319 15:66922443-66922465 AGGAACAAGCAGCTCACACAGGG + Intergenic
1129469165 15:75740848-75740870 AGGGTCAAGCTGCTGATACTAGG - Intergenic
1133406717 16:5530403-5530425 AAGGTCAAGCAGCTATTAGATGG + Intergenic
1133795215 16:9040929-9040951 AGGGTTGAGTAGCTGCTACAAGG - Intergenic
1137457246 16:48627337-48627359 AGGGTCACACAGCTCCTGAATGG + Intergenic
1137669995 16:50273267-50273289 AAGGTCACACAGCTCCTCCAAGG + Intronic
1141669587 16:85484886-85484908 AGGGTGAGGCAGCACCCACATGG - Intergenic
1146379986 17:32321258-32321280 AGGGAAAAGCAGCACCCACAGGG + Exonic
1148194325 17:45702338-45702360 AGGGTCAAGGAGAGCCTGCAAGG - Intergenic
1153387026 18:4510261-4510283 TGGGTCAGGTAGCTCCTCCAGGG - Intergenic
1154060673 18:11056695-11056717 AAGGTCTAGCAGCTCCTGGATGG - Intronic
1154060731 18:11057136-11057158 AGGGTCTAGCGGCTCCTGGATGG + Intronic
1155439679 18:25849125-25849147 AGGCTCAGGCAGGTCCTTCAGGG + Intergenic
1158984444 18:62800044-62800066 AGGGTCTAGCATCTCCTGCTAGG - Intronic
1160018859 18:75165074-75165096 AGGGTACCCCAGCTCCTACAGGG - Intergenic
1163036478 19:14572034-14572056 AGGGTCACCTAGCTCCTACCCGG + Exonic
1165809347 19:38601405-38601427 AGGGTCAAGGAGATCCTGTAGGG - Intronic
1168604136 19:57744647-57744669 AGAGTCAAACAGCTCCTTCCAGG + Intronic
926147466 2:10405391-10405413 AGGGACAGGCAGCTCTTCCAGGG - Intronic
927874258 2:26644209-26644231 AGGCTCAAGCAGCTCATTGAGGG + Intergenic
927886753 2:26723512-26723534 ATGGCCCAGCAGCTCCTACTTGG - Intronic
929552812 2:42905183-42905205 AGGGTCACACAGCTCCCAGATGG + Intergenic
930862944 2:56093281-56093303 AGTGTCATTCAGCTCCTACTGGG - Intergenic
931381309 2:61756133-61756155 AGGGCCAGGCAGCTTTTACAAGG + Intergenic
933624858 2:84586740-84586762 AGGGTCACGCAGTTACTAAATGG + Intronic
933731762 2:85461681-85461703 AGGAACAAGCAGGTGCTACAGGG + Intergenic
937211691 2:120276871-120276893 AGGGTCACGCAGCTCACAAATGG + Intronic
937255410 2:120552051-120552073 ATGGTTAAGTAGCTCCTCCAAGG + Intergenic
939292185 2:140210905-140210927 AGAGTCAAGTAACTTCTACAGGG + Intergenic
940688156 2:156880364-156880386 AAGGTCAAGGATCTCCTTCAAGG - Intergenic
943342045 2:186693814-186693836 AGGGTCTACCAGCTCCCAGAAGG + Intergenic
943530110 2:189068864-189068886 AGGGAGAAGCAGGTCCTACAGGG - Exonic
944544991 2:200790369-200790391 AGAGCCAAGAAGCTCCCACAGGG + Intergenic
944614657 2:201448301-201448323 AAGGTCATGTAGCTACTACATGG - Intronic
947409282 2:229818485-229818507 AAGGCCCAGCAGCTACTACAAGG - Exonic
1170732500 20:18987053-18987075 AGGGTCAACCTTCTCCTTCAAGG + Intergenic
1170973556 20:21139737-21139759 AGTCTTAAGCAGCTCATACAAGG - Intronic
1173430932 20:42986713-42986735 AGGCTCATGAAACTCCTACAAGG + Intronic
1174400796 20:50274873-50274895 AGAGTCATGCAGCTGGTACATGG + Intergenic
1174542728 20:51302794-51302816 AGTGTCATGCAGCTCATACACGG + Intergenic
1175603345 20:60292731-60292753 AGGGTCAAGAAACTCAGACAAGG - Intergenic
1181751518 22:24992190-24992212 AGGGTAACTCTGCTCCTACAGGG - Intronic
1184075663 22:42175876-42175898 AGGGTCATGCAGCCCCTCCTGGG + Intronic
953343515 3:42155937-42155959 AGGGTCAATCACCTCTTGCAGGG - Intronic
953683619 3:45059188-45059210 AGGGACAAGTGGCTCCTTCATGG + Intergenic
957659673 3:83131527-83131549 AGGTACAAGCAGCTCATTCAAGG - Intergenic
961383470 3:126510607-126510629 AGGGGCAGGCAGCTCCCGCAAGG - Intronic
962158636 3:132976026-132976048 AGGGTCATGCAGCTAGTAAATGG + Intergenic
963074504 3:141333583-141333605 AGGATCAAGAAGCACCAACAGGG + Intronic
964706471 3:159623969-159623991 AGGGACAAGATTCTCCTACAAGG + Intronic
966831080 3:184009627-184009649 ACGGTCAAGCAGATTCTAGATGG + Intronic
968943343 4:3650875-3650897 AGGGACAAGGAACTCCCACATGG + Intergenic
969327923 4:6454388-6454410 AGGGCCAAGCAGCTTCCACCTGG + Intronic
969976530 4:11108176-11108198 AGGGACAATCAGGTCATACATGG + Intergenic
972631244 4:40843843-40843865 AAGGTCACACAGCTACTACATGG + Intronic
974340882 4:60614002-60614024 AGGCTTCAGCAGATCCTACAGGG - Intergenic
977663812 4:99621672-99621694 AGGGTCAAGTTGCTGCTATATGG - Intronic
979650234 4:123120914-123120936 AGCCTCAGGCAGGTCCTACAGGG + Intronic
982306224 4:153933947-153933969 AGGGGCAGACAGCACCTACAGGG - Intergenic
984765052 4:183394051-183394073 AAGGTCATGCAGGTCTTACATGG - Intergenic
985141096 4:186840956-186840978 AGGGACCAGCAGCTCCGGCAGGG - Intergenic
985750660 5:1672403-1672425 AAGGTCAAGCAGCTATTAGATGG - Intergenic
986733583 5:10652440-10652462 AGGGTCAGGCAGCTTCTGCTCGG + Intergenic
989170509 5:38467504-38467526 AGGGGGTAGCAGCTCCTGCAGGG - Intergenic
990970468 5:61500524-61500546 AAGGCCAGGCAGCTCTTACAGGG - Intronic
992400648 5:76408258-76408280 AGGGTCAGGTAAGTCCTACAGGG + Intronic
998593390 5:143501663-143501685 AGGGTGAAGAAGCTTCCACAGGG - Intergenic
999199609 5:149806359-149806381 AAGGTCAGGCAGCCCCTTCATGG - Intronic
1001441677 5:171748587-171748609 AATGTCAAGCATCTACTACAAGG + Intergenic
1007714756 6:43849340-43849362 AGGGTCACGCAGCTCCTGTTAGG + Intergenic
1007807809 6:44463638-44463660 AAGGTCACACAGCTCCTTCATGG - Intergenic
1010407615 6:75522687-75522709 TGGGTAAAGCAGCTACCACAAGG + Intergenic
1010480638 6:76348610-76348632 AAGGTCAAGCAGCTTCTAAATGG + Intergenic
1012649392 6:101734667-101734689 AGGCTGGAGCAGATCCTACAGGG + Intronic
1013711490 6:112905485-112905507 AGTGTCAAGCAGCTAGTAAAGGG + Intergenic
1014270632 6:119331947-119331969 AGGGTCGAGCAGCTCCTGCGAGG - Intronic
1016145257 6:140663900-140663922 TGGTTCAATCAGCTCCTACCAGG - Intergenic
1018955815 6:168410068-168410090 AGGGTACAGCAGATCCTTCAGGG - Intergenic
1019280653 7:198183-198205 AGGGCCAAGCAGGGCCTGCAAGG + Intronic
1020984163 7:15111452-15111474 AGGGTTGAGCAGGTCTTACATGG - Intergenic
1022089606 7:27098671-27098693 AGGGCCAAGGATCTCCTACTCGG - Intergenic
1022203585 7:28141238-28141260 ATGAACAAGCACCTCCTACATGG + Intronic
1024604281 7:51011804-51011826 AGGGGGAAGTAGCTCCTGCAGGG - Intergenic
1024929849 7:54658467-54658489 ACAGTCAAGGAGCTCCTACGTGG + Intergenic
1027979990 7:85205763-85205785 CAGGGCAAGCAGCACCTACATGG - Intergenic
1030077881 7:105752063-105752085 CTGGTTAAGCAGCTTCTACAAGG + Intronic
1033101001 7:138471975-138471997 AGGGTCATGCTCCTCCTGCAAGG + Intronic
1034462316 7:151204779-151204801 TTGGTCCAGCAGCTCCTGCAGGG + Exonic
1035823500 8:2620118-2620140 AGGGTCAAGTGCCACCTACAAGG + Intergenic
1037044098 8:14275827-14275849 GGGGTAAAGTAACTCCTACAGGG - Intronic
1037985975 8:23290657-23290679 AGGGTCAAGCAGCTCCTACATGG - Intronic
1038479836 8:27894247-27894269 AGGGTCACACAGCTGCCACATGG + Intronic
1038994101 8:32902242-32902264 AGGATAAATTAGCTCCTACAAGG + Intergenic
1042575322 8:70211650-70211672 AGGTTCAAAAAGCTCCTAAATGG + Intronic
1044546396 8:93465105-93465127 TGGAACAAGCAGCTCCTGCATGG - Intergenic
1049557961 8:143292846-143292868 TGGGTGATGCAGCTCCCACAGGG + Intronic
1050583378 9:7084614-7084636 AAGATCATGCAGCTCCTAAATGG - Intergenic
1052631426 9:31046195-31046217 AAGGTCAAGTAGCTGTTACAGGG + Intergenic
1054870175 9:70042206-70042228 AGGGTGGAGCAGGTCCTATAGGG + Intergenic
1057527370 9:95815021-95815043 AGGGGCAAGCAGTCCCTGCAAGG + Intergenic
1059646491 9:116273174-116273196 AGGCTCAAGCATCTCTTTCAGGG - Intronic
1059842985 9:118239241-118239263 AGGGTAAAACAGCTTGTACAAGG + Intergenic
1185834829 X:3335572-3335594 AGGGCCAAGAAGGTCTTACAGGG + Intronic
1186918118 X:14245777-14245799 AGCGTCAACCAAATCCTACAAGG + Intergenic
1187069837 X:15877568-15877590 CAAGTCAAGCAGTTCCTACAAGG - Intergenic
1194973371 X:100368583-100368605 AGGGTCCAGCAGCTCCTGGAAGG - Intronic
1196881888 X:120206325-120206347 TGGCTCAAGCAGCTGCGACAGGG + Intergenic