ID: 1037986540

View in Genome Browser
Species Human (GRCh38)
Location 8:23294070-23294092
Sequence GCTGGGGCCCAGTCCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037986533_1037986540 6 Left 1037986533 8:23294041-23294063 CCGAGCTGGGGCCTGGGAGCGCC 0: 1
1: 0
2: 3
3: 31
4: 376
Right 1037986540 8:23294070-23294092 GCTGGGGCCCAGTCCTCAGGAGG No data
1037986534_1037986540 -5 Left 1037986534 8:23294052-23294074 CCTGGGAGCGCCATTGCTGCTGG 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1037986540 8:23294070-23294092 GCTGGGGCCCAGTCCTCAGGAGG No data
1037986532_1037986540 7 Left 1037986532 8:23294040-23294062 CCCGAGCTGGGGCCTGGGAGCGC 0: 1
1: 1
2: 4
3: 45
4: 415
Right 1037986540 8:23294070-23294092 GCTGGGGCCCAGTCCTCAGGAGG No data
1037986528_1037986540 18 Left 1037986528 8:23294029-23294051 CCTTCTGAAAACCCGAGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1037986540 8:23294070-23294092 GCTGGGGCCCAGTCCTCAGGAGG No data
1037986525_1037986540 28 Left 1037986525 8:23294019-23294041 CCAGAAACAGCCTTCTGAAAACC 0: 1
1: 0
2: 1
3: 22
4: 271
Right 1037986540 8:23294070-23294092 GCTGGGGCCCAGTCCTCAGGAGG No data
1037986524_1037986540 29 Left 1037986524 8:23294018-23294040 CCCAGAAACAGCCTTCTGAAAAC 0: 1
1: 0
2: 2
3: 29
4: 299
Right 1037986540 8:23294070-23294092 GCTGGGGCCCAGTCCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037986540 Original CRISPR GCTGGGGCCCAGTCCTCAGG AGG Intronic
No off target data available for this crispr