ID: 1037989579

View in Genome Browser
Species Human (GRCh38)
Location 8:23311305-23311327
Sequence AGGTGCACACAGATGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037989570_1037989579 18 Left 1037989570 8:23311264-23311286 CCACTCGCAAGAATTGGGTGTGG 0: 1
1: 0
2: 1
3: 5
4: 42
Right 1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG No data
1037989577_1037989579 -7 Left 1037989577 8:23311289-23311311 CCAAAGGGTAGGGAAAAGGTGCA 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037989579 Original CRISPR AGGTGCACACAGATGGCACA TGG Intronic
No off target data available for this crispr