ID: 1037990795

View in Genome Browser
Species Human (GRCh38)
Location 8:23320074-23320096
Sequence ACGGTCACCAAGAGGGACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037990786_1037990795 15 Left 1037990786 8:23320036-23320058 CCGCCGTTCAGGCGCAGCTGCAG 0: 1
1: 0
2: 1
3: 15
4: 131
Right 1037990795 8:23320074-23320096 ACGGTCACCAAGAGGGACAAGGG 0: 1
1: 0
2: 1
3: 7
4: 104
1037990787_1037990795 12 Left 1037990787 8:23320039-23320061 CCGTTCAGGCGCAGCTGCAGACA 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1037990795 8:23320074-23320096 ACGGTCACCAAGAGGGACAAGGG 0: 1
1: 0
2: 1
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037990795 Original CRISPR ACGGTCACCAAGAGGGACAA GGG Intronic
902393741 1:16120820-16120842 AAGGTCACAAAGATGGATAAGGG - Intergenic
902795843 1:18799935-18799957 ACCGTGGCCAACAGGGACAATGG - Intergenic
903563359 1:24245761-24245783 AAGGTCCCCGGGAGGGACAAAGG - Intergenic
903610309 1:24606625-24606647 AAGGTGACCAGGAAGGACAAAGG - Exonic
909111079 1:71478481-71478503 ACGGCCACTAAGAAGGCCAAAGG - Intronic
911986888 1:104638084-104638106 AGGGTCACCCAGAAAGACAAGGG - Intergenic
917791896 1:178504362-178504384 CAGGTCTCCAACAGGGACAAAGG + Intergenic
920517170 1:206593786-206593808 ACGGTCACCTGGGGGGACAGTGG + Exonic
920863312 1:209729579-209729601 TCAGACACCAAGAAGGACAAAGG + Intronic
921678992 1:218009108-218009130 ATGGTCACCAAAAGGAAAAAAGG + Intergenic
1066519050 10:36195524-36195546 CTGGTCACCAGGAAGGACAAAGG - Intergenic
1071867307 10:89748703-89748725 ACATTCACCAAGAGGGACAAAGG - Intronic
1074862866 10:117525497-117525519 AAGGTCACAGAGAGAGACAATGG + Intergenic
1076284868 10:129284874-129284896 AGGATCACCAAGGGGCACAATGG + Intergenic
1078864688 11:15286452-15286474 ACAGTTACCAAGAGGACCAAGGG - Intergenic
1081145716 11:39561167-39561189 ACACTCACCAAGAGGGTCCATGG + Intergenic
1087865190 11:103217058-103217080 ACAGTTACCAAGAGGGAGATGGG - Intronic
1092480899 12:8858214-8858236 ACGGTCACCCAGAGCCACAGTGG - Intronic
1096779828 12:53985413-53985435 TCGCTCTCCAAGAGGGACGAGGG + Exonic
1098542664 12:71675115-71675137 AGGGTCACCAAGAGTAAGAAAGG + Intronic
1099849969 12:88081214-88081236 AATGTCCCCAAGAGGGACAATGG + Intronic
1099947415 12:89260263-89260285 ACGCTTACCAAGGGGGACTATGG + Intergenic
1109133018 13:58611754-58611776 ACGCCCTGCAAGAGGGACAATGG + Intergenic
1110242630 13:73285893-73285915 CCAGTCACCAAGAGAGGCAAAGG - Intergenic
1120028508 14:79613082-79613104 ACAGGCAGCAAGAAGGACAAAGG - Intronic
1121413105 14:93761447-93761469 ACAGTGACCACGAGGGACAGTGG - Intronic
1202913052 14_GL000194v1_random:137521-137543 ACCGTTGCCAGGAGGGACAATGG - Intergenic
1202879598 14_KI270722v1_random:45162-45184 ACCGTTGCCAGGAGGGACAATGG + Intergenic
1130026707 15:80276763-80276785 TTGGTCACCAGGAGGGATAAGGG + Intergenic
1132299121 15:100765672-100765694 ACGGTCACTGAGAGGAAGAACGG + Intergenic
1133215913 16:4292458-4292480 CCAGTCACCCAGAGGGACACTGG - Intergenic
1143179426 17:4974875-4974897 ACCTTCACCATGGGGGACAAAGG - Intronic
1146622114 17:34406740-34406762 AAGGTCACCAACAGTGACAGTGG + Intergenic
1149423434 17:56532437-56532459 ACAGTCAACAAGCTGGACAAAGG + Intergenic
1150621157 17:66808629-66808651 ACAGTCACCAGGAAGGACAAGGG + Exonic
1151315724 17:73321102-73321124 AAGGTCACCAAGAGGCAACAAGG + Intergenic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1155604914 18:27594093-27594115 ATGGTGACCAAGAGGGAGAGCGG - Intergenic
1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG + Exonic
1159443826 18:68514722-68514744 ACAGTAGCCAAGAGTGACAAAGG + Intergenic
1160055642 18:75477381-75477403 AAGGACACCAAGAGGCAGAATGG + Intergenic
1160412168 18:78682512-78682534 ACACTCACCAAGAGGGAGAGTGG - Intergenic
1164989286 19:32673107-32673129 ACAGTCACAAAGAGGCACAACGG + Intronic
1166728822 19:45046062-45046084 ACGTTCACATACAGGGACAAAGG - Intronic
1202655217 1_KI270708v1_random:14168-14190 ACCGTTGCCAGGAGGGACAATGG + Intergenic
930526116 2:52531776-52531798 ACTGTCAAGAAGAGTGACAATGG + Intergenic
933390519 2:81660950-81660972 ACAATCACCAAGAGCAACAATGG + Intergenic
933686860 2:85148364-85148386 ACTGCCACCTGGAGGGACAAGGG - Intronic
938386519 2:130870768-130870790 ACGGTCACCCAGCGAGACATGGG + Intronic
939792364 2:146593766-146593788 AAAGTCACCAAGAAAGACAAAGG + Intergenic
941956496 2:171210866-171210888 ACTGTTACCAGGAGGGAGAAGGG + Intronic
943708695 2:191064337-191064359 ACAGTCACCATGATGTACAATGG + Intronic
944979462 2:205098714-205098736 CCAGGCACCAAGAGGGGCAACGG - Intronic
948073648 2:235147997-235148019 AGGACCACCAAGAGGCACAAGGG - Intergenic
948284421 2:236772739-236772761 AGTGTCAGCAGGAGGGACAAAGG - Intergenic
1170003632 20:11642416-11642438 AATGTGACCAAGAAGGACAATGG + Intergenic
1170377952 20:15722552-15722574 ACAGTCAACAAGGGGGAAAATGG - Intronic
1172031226 20:31983585-31983607 AGGGTCCCCGGGAGGGACAAAGG + Intronic
1172225096 20:33300184-33300206 ACTGTCACCCAGAGTGACATGGG + Intronic
1175846777 20:62063953-62063975 AGGGTCACCAAGGGGCAGAAAGG + Intronic
1176640901 21:9302623-9302645 ACCGTTGCCAGGAGGGACAATGG + Intergenic
1180388281 22:12200247-12200269 ACCGTTGCCAGGAGGGACAATGG - Intergenic
952953966 3:38545208-38545230 AGGGCCACCTGGAGGGACAAGGG + Intergenic
954130728 3:48559376-48559398 AGGGTCAGGAAGAGGGAGAAGGG + Intronic
955755471 3:62220973-62220995 ACAGTGACCAAGAAGGACCATGG + Intronic
961822261 3:129581053-129581075 GCGGGGACCATGAGGGACAATGG + Intronic
961829314 3:129615355-129615377 ACGGTCACCTTGAGGGCCAGTGG - Intergenic
964877546 3:161385451-161385473 ATGGTCACTAGGAGGGAGAAAGG + Intergenic
1202745992 3_GL000221v1_random:102400-102422 ACCGTTGCCAGGAGGGACAATGG - Intergenic
972304383 4:37818148-37818170 ACAGTCAACAAGAGAGTCAATGG + Intergenic
972876330 4:43365587-43365609 ACTGTCCCCAAGAGGAAGAAGGG - Intergenic
976890554 4:90041311-90041333 ACGGTCACAGAGATGGAAAATGG - Intergenic
982424132 4:155236942-155236964 ACACTCACCAAGAGGGACTGCGG - Intergenic
983062798 4:163177398-163177420 GCTGTCACCCAGAGGGCCAAAGG + Intergenic
992146175 5:73851556-73851578 AGTCTCACCAAGGGGGACAAAGG + Intronic
998400043 5:141843932-141843954 ACGGTCAAGGAAAGGGACAAGGG + Intergenic
1006561696 6:34918386-34918408 ACAGTCACCATGAGGGTCAAAGG + Intronic
1007235426 6:40387931-40387953 GAGGTCACCAAGAGGGAAGAAGG + Intergenic
1009268073 6:61580840-61580862 ACACTCACCAAGAGGGTCCATGG + Intergenic
1017422582 6:154288143-154288165 ATGGTCACCAAAAAGCACAATGG + Intronic
1017452958 6:154571504-154571526 AATGTCACAAACAGGGACAAGGG + Intergenic
1018131368 6:160735037-160735059 AGGGACACCAAGAGGGAGGAAGG + Intronic
1018153767 6:160965742-160965764 AAGCTCACCAGGAGAGACAAGGG + Intergenic
1019546904 7:1582268-1582290 ACAGTCAGGAAGATGGACAATGG - Intergenic
1020825099 7:13016903-13016925 ACGCCCTCCAAGGGGGACAAGGG + Intergenic
1022519288 7:30995437-30995459 AAGGCCACCAAGAGGCAGAAGGG - Intergenic
1027197857 7:76043472-76043494 AGGGCCACCGAGAGGGAAAATGG + Intronic
1028465943 7:91151804-91151826 ATGGTCACTAAGATGGAGAAAGG + Intronic
1030221757 7:107105725-107105747 ACTGTCACTAAGAGGGCCACTGG - Intronic
1031401068 7:121327061-121327083 AGCTTCTCCAAGAGGGACAATGG - Intronic
1032854383 7:135822330-135822352 ACGGAGACAAAGAGGGACTAGGG - Intergenic
1035132175 7:156665532-156665554 ACGTTCACCAACAGTGAGAATGG - Intronic
1037384416 8:18322281-18322303 ATAGTCACCAAGATGTACAATGG + Intergenic
1037676510 8:21055732-21055754 ACAGTGACCAAAAGGGACAAGGG - Intergenic
1037990795 8:23320074-23320096 ACGGTCACCAAGAGGGACAAGGG + Intronic
1040308933 8:46226682-46226704 AAGGTCCCCAAAAGGGAAAATGG + Intergenic
1043330107 8:79105838-79105860 ACTGTGACCAAGAGAGATAATGG + Intergenic
1043454779 8:80402410-80402432 ATGGTCAGCAGGATGGACAACGG - Intergenic
1046127491 8:109928470-109928492 ACAGTCAGCAAAAAGGACAATGG - Intergenic
1046740242 8:117820037-117820059 AACATCACCAAGAGGGGCAAAGG - Intronic
1053280038 9:36814545-36814567 ACTGTTTCCAAGAGGGACAAAGG - Intergenic
1060076747 9:120597663-120597685 ACAGTCACTAAGAGGGATTAGGG - Intergenic
1061245864 9:129401057-129401079 ACGGTCCCCAAGAGGGAGATGGG - Intergenic
1203687396 Un_GL000214v1:7941-7963 ACCGTTGCCAACAGGGACAATGG + Intergenic
1203755236 Un_GL000218v1:119817-119839 ACCGTTGCCAGGAGGGACAATGG - Intergenic
1203714614 Un_KI270742v1:132358-132380 ACCGTTGCCAGGAGGGACAATGG - Intergenic
1203648879 Un_KI270751v1:96112-96134 ACCGTTGCCAACAGGGACAATGG - Intergenic
1185505862 X:631888-631910 ACGGTCACCCAGACGCACAGAGG + Intronic
1187407091 X:19014038-19014060 ATGGTCAGCAAGACAGACAATGG + Exonic
1192190616 X:68989167-68989189 ATGGGAACCAAGAGGGAAAAAGG + Intergenic
1198306998 X:135393363-135393385 ACCATCACACAGAGGGACAACGG - Intergenic
1201858861 Y:18573397-18573419 ACTGTGACCAGGAGGCACAAAGG - Intronic
1201874461 Y:18746984-18747006 ACTGTGACCAGGAGGCACAAAGG + Intronic