ID: 1037999704

View in Genome Browser
Species Human (GRCh38)
Location 8:23381043-23381065
Sequence CATGGTTACCCGCCCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037999704 Original CRISPR CATGGTTACCCGCCCCCCAG TGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901494520 1:9613553-9613575 CATGCTTCCCCCTCCCCCAGGGG - Exonic
904671701 1:32170953-32170975 ACTGGTTTCCCGCCCACCAGAGG - Exonic
922415464 1:225418337-225418359 CATGGTTGCCAGGCCACCAGAGG - Intronic
1070540602 10:77412652-77412674 CTTGGTAACCAGCCCCCCTGGGG - Intronic
1074870526 10:117572277-117572299 CAAGGTTACCCCCCTCCCTGGGG - Intergenic
1082992598 11:59220863-59220885 CATGGTCTCCCCCTCCCCAGTGG + Intergenic
1083393117 11:62369761-62369783 CATGGTTAGACGCCACCCACAGG - Intronic
1092032043 12:5294437-5294459 CAGGGTTACCCGGACCCCGGGGG - Intergenic
1093809383 12:23473230-23473252 CATGGTTCCTGGCTCCCCAGGGG + Intergenic
1095044534 12:37486553-37486575 CATAGCTACACTCCCCCCAGAGG + Intergenic
1108048035 13:46401789-46401811 AATGATTACCCAACCCCCAGTGG - Intronic
1108672268 13:52703683-52703705 CATGGGTAATAGCCCCCCAGGGG + Exonic
1112595528 13:100803949-100803971 TATTGTTACCCTCCCACCAGTGG + Intergenic
1122070162 14:99200891-99200913 CATGGGAAGCAGCCCCCCAGTGG + Intronic
1122689219 14:103523537-103523559 CAAGTTTACCCGACCCCCAAAGG + Intergenic
1125744103 15:41987447-41987469 CATGGTTGCCTGGCACCCAGGGG + Intronic
1128389099 15:67170831-67170853 CACGTCTACCCGCCCCCCAGGGG - Intronic
1128449381 15:67794602-67794624 CAGAGTTACCCGACCCTCAGTGG - Intronic
1129360225 15:75019809-75019831 CCTGGGTACCTGACCCCCAGGGG + Exonic
1141634082 16:85304446-85304468 CAGGGTAGCCCGCCCGCCAGGGG + Intergenic
1144371402 17:14594928-14594950 CATGCTTCCCCTCCCCTCAGGGG + Intergenic
1144669675 17:17125903-17125925 CATGGTTACCACCACACCAGGGG - Intronic
1144949757 17:18987662-18987684 CATGGTTTCCCCCACCCCAAAGG + Intronic
1152277356 17:79365879-79365901 CATGGTTACCGGGCACCCAGAGG - Intronic
1161129302 19:2578883-2578905 CCTGGCTCCCGGCCCCCCAGGGG + Intronic
1162143261 19:8597156-8597178 CATGGGCACCCACCACCCAGGGG + Intronic
1164813613 19:31177367-31177389 CATGGTTGCCCTCCCTCAAGGGG + Intergenic
1165091527 19:33390683-33390705 CAAGGTTCCCCGGCCCTCAGAGG - Intronic
1167151015 19:47709745-47709767 CCTGGGTCCCCGCCACCCAGAGG - Intergenic
1168280460 19:55302735-55302757 CATGGCTACCCGGCGGCCAGGGG - Exonic
933089880 2:78106851-78106873 GATGGGTACCCGCCCCACAGTGG + Intergenic
933158951 2:79003078-79003100 CATGGTGACCAGCAGCCCAGAGG + Intergenic
938648383 2:133354079-133354101 CATGTTTCCCCTCCCCTCAGGGG + Intronic
939730221 2:145775164-145775186 CATTGTTACCTGCCCCCCACTGG - Intergenic
1171801954 20:29630093-29630115 CATAGCTACACTCCCCCCAGAGG - Intergenic
1171842021 20:30225493-30225515 CATAGCTACACTCCCCCCAGAGG + Intergenic
1179712144 21:43269445-43269467 CATTGTTACCGGCTCCCCAGAGG + Intergenic
1180100082 21:45579837-45579859 CAGGGGCACCCGCCTCCCAGGGG - Intergenic
1180840925 22:18958475-18958497 GATGGTTGCCCGAGCCCCAGTGG + Intergenic
1181060564 22:20280299-20280321 GATGGTTGCCCGAGCCCCAGTGG - Intronic
969640303 4:8394311-8394333 CCACGTTACCCGCCCCTCAGTGG - Intronic
976595591 4:86892273-86892295 CCTGGTTACCCGGGCTCCAGGGG + Intronic
979209442 4:118081627-118081649 CATTATTTCCTGCCCCCCAGAGG + Intronic
988676549 5:33439372-33439394 CGTGATTACCCACCCCTCAGAGG + Intergenic
990622564 5:57576506-57576528 CATGGTTACTTCCCCTCCAGGGG - Intergenic
990753096 5:59039357-59039379 CTTGGGTGCCCGCCCCGCAGAGG + Intronic
992139271 5:73779784-73779806 CCTGGTTGCCCACCCCCCATGGG - Intronic
1012075066 6:94672757-94672779 CATGGCTACCCCTCCCCCAGGGG - Intergenic
1012413598 6:98988167-98988189 TATGGATACCTGCCACCCAGAGG + Intergenic
1012623929 6:101383382-101383404 CATGGTTACTTTCTCCCCAGTGG - Intergenic
1019132389 6:169886770-169886792 CATGGTGGCCCGCCGCCCACCGG - Intergenic
1022156071 7:27662913-27662935 CGTGGGCACCCGCCCCCGAGCGG - Exonic
1023402829 7:39802849-39802871 GATGGTTACCCTGTCCCCAGAGG + Intergenic
1024646799 7:51377788-51377810 GATGGTTACCCTGTCCCCAGGGG - Intergenic
1025290461 7:57716095-57716117 CATAGCTACACTCCCCCCAGAGG + Intergenic
1032279334 7:130488217-130488239 CAGGGTTACCCAGCCCCCAGTGG + Intronic
1033018591 7:137698527-137698549 CATGGTTATACTCTCCCCAGGGG - Intronic
1037999704 8:23381043-23381065 CATGGTTACCCGCCCCCCAGTGG - Intronic
1038701760 8:29855665-29855687 CATGGTTTCCCTTCCCTCAGTGG + Intergenic
1040459750 8:47635818-47635840 CATGCTTACCTGCTTCCCAGTGG + Intronic
1040747638 8:50664619-50664641 CATGATCACCTGCCTCCCAGAGG + Intronic
1042479539 8:69287894-69287916 CAGGGTCACACTCCCCCCAGAGG + Intergenic
1050112170 9:2228297-2228319 GATGGTTTGGCGCCCCCCAGGGG - Intergenic
1054165972 9:61729273-61729295 CATAGCTACACTCCCCCCAGAGG - Intergenic
1058853833 9:109040006-109040028 CTTGGTTACTTGCCACCCAGAGG - Intronic
1061937473 9:133866138-133866160 CCTGGTTCCAGGCCCCCCAGGGG + Intronic
1062623174 9:137431645-137431667 CCTGGTCACTCGCACCCCAGTGG - Intronic
1189248002 X:39578479-39578501 CCTGCTTAGCCGCCCGCCAGGGG - Intergenic
1190146326 X:47894663-47894685 CAGGGCTACCTGCCACCCAGTGG + Intronic
1195319747 X:103711930-103711952 CATTGTTTCCCATCCCCCAGAGG + Intronic
1201647926 Y:16255786-16255808 CTTGGTCAACCTCCCCCCAGGGG - Intergenic
1201654884 Y:16329515-16329537 CTTGGTCAACCTCCCCCCAGGGG + Intergenic