ID: 1038003106

View in Genome Browser
Species Human (GRCh38)
Location 8:23407137-23407159
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038003100_1038003106 16 Left 1038003100 8:23407098-23407120 CCTAGGAGACTACTTCAGGACAA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr