ID: 1038003398

View in Genome Browser
Species Human (GRCh38)
Location 8:23409602-23409624
Sequence TGTACACTGTACACTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038003398 Original CRISPR TGTACACTGTACACTGCTGT GGG (reversed) Intronic
904515518 1:31051859-31051881 TTTTCTCTGTAAACTGCTGTGGG - Intronic
906621112 1:47280348-47280370 TGCACACTGTGCAAGGCTGTGGG + Exonic
912081222 1:105939140-105939162 GGTACAGTGTATACTGCTCTGGG - Intergenic
913166541 1:116192352-116192374 CCTACCCTGTTCACTGCTGTAGG - Intergenic
918799422 1:188953495-188953517 TGTACAATTCACACTTCTGTGGG - Intergenic
919571362 1:199253022-199253044 GGTACAGTGTACACTGCTTGGGG - Intergenic
1065894095 10:30146439-30146461 GGTACAGTGTACACTGCTTGGGG - Intergenic
1066387565 10:34954146-34954168 TGTAAACTGTAAAGTGCTATAGG + Intergenic
1068229575 10:54154626-54154648 TATACACTGTACTGTGCTGAAGG + Intronic
1069078242 10:64061216-64061238 TGTACAATGTAAAGTGTTGTAGG + Intergenic
1069281631 10:66661671-66661693 TGTACATTGTACATAGTTGTTGG - Intronic
1070211277 10:74324856-74324878 GGAACCCTGTACACTGCTGATGG - Intronic
1072304930 10:94097938-94097960 TGTCGCCTGTCCACTGCTGTAGG - Intronic
1075905416 10:126077327-126077349 TGTAATCTGTACATTGCTTTGGG - Intronic
1077844167 11:6006678-6006700 TGTAGACTGAAAACTTCTGTAGG - Intergenic
1084620821 11:70269415-70269437 TGTCCACTGGCCACTGCTGTTGG - Intergenic
1086298064 11:85393949-85393971 GGTACAGTGTACACTGCTCAGGG + Intronic
1092769567 12:11884440-11884462 TGTAGACTGTAGACTGCTTTGGG + Exonic
1092911027 12:13145128-13145150 TGGACACTTTACAAAGCTGTGGG + Intergenic
1093096353 12:14976183-14976205 TGTACACCATGCACTGTTGTAGG + Intronic
1093616850 12:21236100-21236122 TCTCCACTGTACACTGTTGTGGG - Intronic
1093885865 12:24459633-24459655 GGTACCCTGTATACTCCTGTCGG - Intergenic
1095176946 12:39103458-39103480 TGCTCACTGAACACTGCTGATGG + Intergenic
1099248531 12:80222984-80223006 GGTACAATGTACACTGCTCAGGG - Intronic
1100059171 12:90551721-90551743 GGTACAGTGTACACTGCTCGAGG - Intergenic
1101464916 12:104938667-104938689 TGTACCCTGTTGATTGCTGTGGG - Intronic
1101724954 12:107381344-107381366 TGTACACAGCACACTCTTGTGGG - Intronic
1107078003 13:36344829-36344851 TGAAGACTGTACACTGGTGTAGG - Intronic
1108990317 13:56648231-56648253 TCTACATTGTACACTGGTGGTGG - Intergenic
1108997517 13:56752988-56753010 TGTAAACTGTAGACTGCTATGGG + Intergenic
1109121049 13:58457922-58457944 TGTAGATTGTAGACTGCTTTGGG - Intergenic
1110678832 13:78283789-78283811 GGAACACTTTACACTGTTGTTGG - Intergenic
1111385164 13:87516858-87516880 TGTAGACTGTACCCTTCTGGTGG + Intergenic
1111576498 13:90161455-90161477 TGAACACTTTTCACTGCTGGTGG + Intergenic
1114231936 14:20790979-20791001 TGAACCCTAGACACTGCTGTGGG + Intergenic
1114374984 14:22135272-22135294 TGTACAGTGTACAGTGTTCTTGG + Intergenic
1114877993 14:26747199-26747221 GGAACACTGTACACTGTTGGTGG + Intergenic
1117444147 14:55787752-55787774 TCAACCCAGTACACTGCTGTAGG + Intergenic
1117793651 14:59367708-59367730 TGTACTCTCTAGAATGCTGTGGG + Intronic
1118844112 14:69533449-69533471 TGTGCACTGTCTGCTGCTGTGGG + Intergenic
1128480907 15:68036898-68036920 TAAACAGTGTACACTGGTGTTGG - Intergenic
1128664818 15:69530425-69530447 TGTACACTGTGCAATGCCGGAGG - Intergenic
1130722311 15:86400558-86400580 GGTACAATGTACACTGCTCGGGG - Intronic
1137024800 16:35462028-35462050 GGAACACTGTACACTGGTGGTGG - Intergenic
1137039278 16:35595052-35595074 TGGAAACTGGACACTGCAGTAGG - Intergenic
1139229437 16:65269235-65269257 TGGACACTGGAGACTGCTGGAGG - Intergenic
1139389899 16:66600789-66600811 TGTACCCTAGGCACTGCTGTTGG + Intergenic
1142950455 17:3474526-3474548 TGTACACTGAACACTTCAGACGG - Intronic
1143614840 17:8043588-8043610 TGGTCACTGTGCACTGCTGGGGG + Intronic
1145773617 17:27511033-27511055 TGCACACTGCACACAGCTCTTGG + Intronic
1147481178 17:40764828-40764850 TATACACTGTAGAATGCAGTAGG + Intergenic
1147559202 17:41498660-41498682 TGTTGACTGTTCATTGCTGTGGG + Intergenic
1151074827 17:71259050-71259072 TGTACACTATAATCAGCTGTGGG + Intergenic
1152554619 17:81046690-81046712 AGGACACTGTCCACTGCTGCAGG + Intronic
1153842704 18:9021355-9021377 TGTACAATGTCCTCTCCTGTTGG + Intergenic
1156343405 18:36233648-36233670 GGAACACTTTACACTGCTGGTGG - Intronic
1157649607 18:49314322-49314344 TGTTCAATGTACACAGCTGAAGG - Intronic
1158333558 18:56389925-56389947 TGTAAACTGTATTCTGCTGATGG + Intergenic
1158881209 18:61781159-61781181 GGAACACTGTACACTGCTGGTGG + Intergenic
1159185438 18:64966099-64966121 TGTACACTGCACACTGCAGATGG - Intergenic
1160276937 18:77445643-77445665 GGTACAGTGTACACTGCTTGGGG - Intergenic
926290140 2:11522496-11522518 TGGACCCTGCACACTGCTGCAGG + Intergenic
928459885 2:31461875-31461897 TGAACCCTATACACTGCTGGTGG + Intergenic
930937612 2:56974321-56974343 TTAAATCTGTACACTGCTGTGGG - Intergenic
931582578 2:63793151-63793173 TAGACACTGTACTCTGGTGTGGG - Intronic
935457711 2:103289359-103289381 TGTACACTGTACACAGTTCCAGG + Intergenic
935972399 2:108543019-108543041 TATACACTGTACTATGCTATAGG + Intronic
935974197 2:108561225-108561247 GGAACACTATACACTGCTGGTGG - Intronic
938751880 2:134339850-134339872 AGTAAACTGTACACTTCTGATGG + Intronic
939324018 2:140663909-140663931 TGAACACTTGAGACTGCTGTAGG + Intronic
939606774 2:144263292-144263314 TGGATACTGTACACTGATATGGG + Intronic
942213485 2:173694949-173694971 GGTACAGTGTACACTGCTTGGGG + Intergenic
943632456 2:190269602-190269624 GGAACACTTTACACTGCTGGTGG + Intronic
944895269 2:204157539-204157561 TTTACAGTGTACAGTGCAGTGGG + Intergenic
945838627 2:214861851-214861873 GGAACACTCTACACTGCTGGTGG - Intergenic
946341563 2:219072923-219072945 TGTACTCTGTACAAAGCTGGCGG - Intergenic
948166752 2:235868807-235868829 TGTACACTTAACATTGCTTTTGG + Intronic
948301791 2:236913152-236913174 TGTAAACAGAACAATGCTGTTGG + Intergenic
1171192850 20:23171803-23171825 GGAACATTCTACACTGCTGTTGG - Intergenic
1173415151 20:42848433-42848455 GGAACACTTTACACTGCTGGTGG - Intronic
1174743507 20:53039479-53039501 TGTGCACTTGACACTGCTCTAGG + Intronic
1178712314 21:34928801-34928823 TGGACACTGACCACAGCTGTGGG - Intronic
1181144410 22:20834116-20834138 TTTACAGTGAACATTGCTGTTGG + Intronic
1181453450 22:23038928-23038950 GGTGCTCTGTAGACTGCTGTGGG + Intergenic
1183309619 22:37102391-37102413 TCTACACTGTACACTGTAGAAGG - Intronic
949724581 3:7028919-7028941 GGAACCCTGTGCACTGCTGTTGG + Intronic
950274004 3:11643029-11643051 CGTCTACTGTACCCTGCTGTGGG - Intronic
950321631 3:12060245-12060267 TCTACACTGTACAAACCTGTGGG - Intronic
951060251 3:18198280-18198302 GGAACACTTTACACTGCTGGCGG + Intronic
951891617 3:27572977-27572999 TGTAATCTGTGCACTGTTGTGGG - Intergenic
952158827 3:30672532-30672554 TGTACTCTGGACACTGGTCTAGG + Intronic
956755867 3:72385898-72385920 TGTTTACTGGACAGTGCTGTTGG - Intronic
957768253 3:84654985-84655007 GGGACACTTTACACTGCTGGTGG + Intergenic
962591384 3:136892912-136892934 GGTACAGTGTACATTGCTGTTGG - Intronic
965633546 3:170757583-170757605 GGTACAGTGTACACTGCTCGGGG + Intronic
965972627 3:174580945-174580967 TATATACTGTACACTGCTGATGG - Intronic
966413318 3:179665166-179665188 TGTGCACTCTGCACTGCAGTTGG + Intronic
968403553 4:318928-318950 TGTAAACTCTACAGTGTTGTAGG + Intergenic
971722149 4:30258452-30258474 TGTATGCTGTGCACTGCTTTTGG + Intergenic
975099819 4:70500201-70500223 GGAACACTTTACACTGCTGGTGG + Intergenic
976666217 4:87595549-87595571 TGTACATTGTACATTGCTCGGGG - Intergenic
978081623 4:104600045-104600067 TGTACAGTGTACACAGAAGTGGG + Intergenic
979064735 4:116115691-116115713 GGAACACTTTACACTGCTGGTGG + Intergenic
979499700 4:121425876-121425898 TAAACACTGTCCACTTCTGTAGG - Intergenic
980059479 4:128113676-128113698 TCTATACAGTACACTTCTGTAGG - Intronic
980779205 4:137475297-137475319 CCTAAACTGTTCACTGCTGTGGG + Intergenic
980994958 4:139771233-139771255 TATAGACTGTACACTGTTCTGGG + Intronic
982282248 4:153695288-153695310 AGAACCCTGTACACTGTTGTTGG - Intergenic
982336871 4:154249874-154249896 TGGACACTGTGAACTGCTGAGGG + Intronic
982419082 4:155172791-155172813 GGTACAGTGTACACTGCTCAGGG - Intergenic
985705650 5:1400097-1400119 TGTGCATTGGACTCTGCTGTCGG + Intronic
985938150 5:3112277-3112299 TGTAAACTGAGCACTGCTGAAGG + Intergenic
988720275 5:33870502-33870524 AGTACACTGTACACTGTTGTGGG - Intronic
988850554 5:35176368-35176390 TTTACAGTGTACAGTTCTGTGGG + Intronic
989772144 5:45157617-45157639 TGTAGACTGTAGACTACTGTAGG - Intergenic
993754966 5:91717265-91717287 GGAACACTTTACACTGCTGGTGG + Intergenic
995827150 5:116313353-116313375 TATACACTGTGCTCTGATGTTGG + Intronic
1006449175 6:34096130-34096152 TGTACACTGGACACTGTTCCAGG + Intronic
1013089763 6:106889529-106889551 TGTAAACTTTACATTTCTGTTGG + Intergenic
1014323690 6:119965377-119965399 TGTACACTGTAATTTCCTGTTGG + Intergenic
1016423270 6:143907392-143907414 GGAACACTGTACACTGTTGGTGG - Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1019087765 6:169497779-169497801 TGGACCCTGTACACTGTTGGTGG + Intronic
1020861294 7:13495109-13495131 GGTACAGTGTACACTGCTCGAGG + Intergenic
1022370884 7:29770285-29770307 TGAAGACTGCACACTGTTGTGGG + Intergenic
1024849915 7:53700197-53700219 TGGACACTGTAAACTGTTGAGGG + Intergenic
1026598057 7:71751009-71751031 GGAACACTTTACACTGCTGGTGG + Intergenic
1026628508 7:72017492-72017514 TGCACATTGCACACAGCTGTGGG + Intronic
1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG + Intronic
1030258393 7:107537104-107537126 TATACACTTTACACTGTTGGTGG + Intronic
1030338937 7:108355677-108355699 TGTCCACTGTACTGTGCTGTAGG + Intronic
1030552956 7:110987690-110987712 TGCACACTGTACCCATCTGTTGG - Intronic
1032825054 7:135560373-135560395 TGTACACTCTTTGCTGCTGTTGG - Intronic
1035380336 7:158435459-158435481 TGAAGACTGTATACTGTTGTGGG + Intronic
1035823915 8:2623997-2624019 TGCAAACTGTTCACTGCCGTGGG + Intergenic
1035896259 8:3405874-3405896 GGGAGACTGTACACTCCTGTTGG + Intronic
1036654070 8:10664281-10664303 TTAACAGTGTACATTGCTGTTGG + Intronic
1036670435 8:10781715-10781737 GGAACCCTGTACACTGCTGATGG + Intronic
1037140772 8:15517573-15517595 TTTACAGTTTACACAGCTGTTGG + Intronic
1038003398 8:23409602-23409624 TGTACACTGTACACTGCTGTGGG - Intronic
1040542180 8:48370205-48370227 TGTACACTGTGGCCTGCTATTGG + Intergenic
1040793735 8:51266866-51266888 GGTAGACTGGACACTGCTGAGGG - Intergenic
1042328306 8:67551588-67551610 TGGAACCTGTACACTGCTTTTGG + Intronic
1044079965 8:87871454-87871476 TGAAAACAGTACACTGTTGTAGG - Exonic
1044494477 8:92860415-92860437 TGTACATTTTACACTGCTAAGGG - Intergenic
1046576141 8:116031878-116031900 TGTACACTGTGCTCTACTGCAGG - Intergenic
1051660376 9:19420554-19420576 GGAACACTGTACATTGCTGATGG + Intronic
1053063926 9:35053417-35053439 GGAACACTTTACACTGCTGGTGG + Intergenic
1058159849 9:101557769-101557791 AGTACACTGTACTCTTTTGTAGG - Intronic
1203635852 Un_KI270750v1:110184-110206 TGAACACTTGACACTGCTGGTGG + Intergenic
1185807342 X:3070676-3070698 TGTGCAGTGTACACTGCTCAGGG - Intronic
1186511110 X:10130349-10130371 TGTAAAATGGGCACTGCTGTTGG + Intronic
1186703994 X:12122949-12122971 TGTACACTGCACAATTTTGTAGG - Intergenic
1186951629 X:14632662-14632684 AATACACTGTAGACTGCTTTGGG + Intronic
1187987746 X:24833007-24833029 GGTAGAGTGTACACTGCTTTGGG - Intronic
1193686048 X:84578640-84578662 GGAACACTGTACACTGTTGGTGG - Intergenic
1193712239 X:84894036-84894058 TGTAGACAGTACAATACTGTTGG + Intergenic
1196971218 X:121110317-121110339 GGTACAGTGTACACTGCTCAGGG + Intergenic
1198734060 X:139767002-139767024 TGTACATTCTGCACTCCTGTTGG - Intronic
1201542310 Y:15119174-15119196 GGAACACTTTACACTGTTGTTGG + Intergenic