ID: 1038003855

View in Genome Browser
Species Human (GRCh38)
Location 8:23413467-23413489
Sequence CACTGTGTATGAGGGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038003855_1038003861 13 Left 1038003855 8:23413467-23413489 CCATATGCCCCTCATACACAGTG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1038003861 8:23413503-23413525 ATTTTCATCTTGCATTTCGGTGG No data
1038003855_1038003860 10 Left 1038003855 8:23413467-23413489 CCATATGCCCCTCATACACAGTG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1038003860 8:23413500-23413522 ACTATTTTCATCTTGCATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038003855 Original CRISPR CACTGTGTATGAGGGGCATA TGG (reversed) Intronic
901748652 1:11392026-11392048 CACTGGGTGGGAGGGGCATCTGG + Intergenic
904009996 1:27383866-27383888 CACAGCGGATGAGGGGCAGAAGG - Intergenic
911616694 1:100020646-100020668 CACAGTGAATGAAGAGCATATGG + Intronic
911960505 1:104296210-104296232 CAGTTGGCATGAGGGGCATAAGG - Intergenic
912952723 1:114131561-114131583 CCTTGTGTATGAGGGGCTTGGGG + Intronic
919342999 1:196337573-196337595 CACTGTGTTTGAGGCACAAAGGG + Intronic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
924601743 1:245496266-245496288 GAATCTGGATGAGGGGCATATGG + Intronic
1067093161 10:43281708-43281730 CACTGAGAAGGTGGGGCATAAGG - Intergenic
1068778906 10:60898480-60898502 CAGTGTGTATGAGATGCAGAGGG + Intronic
1069570559 10:69492177-69492199 CACTGGGTATGTTGGGCATCTGG + Intronic
1070284163 10:75071452-75071474 CACAGTAGATGAGGGGCTTAGGG - Intergenic
1070982362 10:80659908-80659930 AACTGTCTAGGTGGGGCATATGG - Intergenic
1072195784 10:93116266-93116288 CACTGTCTTTGAGGGGCACAAGG - Intergenic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1073338661 10:102729159-102729181 CACTGTGAGTGAGGGGGAGAGGG + Intronic
1074501375 10:114028047-114028069 CACTTTGTTTGAGGGGCACGGGG - Intergenic
1078367089 11:10715745-10715767 CAGTGTGGAGGAGGGGGATACGG - Intergenic
1080117342 11:28635836-28635858 GACTGTGTATGTTGGGGATAGGG + Intergenic
1084131810 11:67141813-67141835 GGGTGTGTATGAGGGGCAAAGGG - Intronic
1092611744 12:10180239-10180261 CACTCTGTACGGGGGCCATACGG - Intronic
1092778663 12:11965495-11965517 CCCTGTGTAGGAGGGGGCTACGG + Intergenic
1094011135 12:25811009-25811031 CACTGTTTATGATGGACAAAAGG - Intergenic
1094301300 12:28967601-28967623 CACTGTGTATGTTGTGCACAAGG - Intergenic
1097313226 12:58144049-58144071 CAGTGTGTATGAGAGACATTCGG - Intergenic
1103065279 12:117892367-117892389 CTCTTTGTTTGAGAGGCATAAGG - Intronic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1110790866 13:79585303-79585325 CACTTTGTAAGAAGAGCATATGG + Intergenic
1111798872 13:92958266-92958288 CAATTTGACTGAGGGGCATAAGG - Intergenic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1127878682 15:63135849-63135871 CTCTGTGTATAAGGGGGAGAAGG + Intronic
1129962258 15:79697878-79697900 CATTGTGTTTAAGGGGCTTAAGG - Intergenic
1130936222 15:88473005-88473027 AGGAGTGTATGAGGGGCATATGG + Intronic
1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG + Intergenic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1135762908 16:25151871-25151893 CACTTTGAAGGAGGGGCAAAAGG + Intronic
1137386925 16:48050397-48050419 GAATTTGTCTGAGGGGCATAAGG - Intergenic
1137468241 16:48730700-48730722 CACTGTGCAAGAGCTGCATAAGG - Intergenic
1137601767 16:49761092-49761114 CACTGTGTTTGGGAGGCAAAGGG - Intronic
1138201124 16:55089268-55089290 CATTTTGTTTGAGTGGCATATGG + Intergenic
1141297643 16:82784640-82784662 CACTTTGGATAAGGGTCATAGGG + Intronic
1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG + Intronic
1149168130 17:53778762-53778784 CACTGTGGATGATGAGAATAGGG + Intergenic
1150779343 17:68107560-68107582 CACTGGGTATGAGTGGCAAGAGG + Intergenic
1154250919 18:12744210-12744232 CACTCAGGAGGAGGGGCATAGGG - Intergenic
1155087424 18:22471934-22471956 CACTGTGTCTGAAGGGCACTGGG - Intergenic
1157275033 18:46304319-46304341 CACTATGTTTTAGGGGCATCTGG + Intergenic
1158155905 18:54425297-54425319 CCCTGTGTTTGAGAAGCATATGG + Intergenic
1159953361 18:74501847-74501869 CACTGTGTGTGAGGGGGAGCCGG - Intronic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1161714579 19:5868122-5868144 CAGTGTGTCTGAGGGCCAGAGGG - Intronic
1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG + Intergenic
1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG + Intronic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
931047259 2:58369253-58369275 AACTGTGGAAGAGGGGCACAAGG - Intergenic
932870223 2:75390943-75390965 CAATTTGACTGAGGGGCATAAGG + Intergenic
935225426 2:101048094-101048116 CCCTGTGTGTGTGGGGCACATGG - Intronic
936419762 2:112352589-112352611 CACTGTGTGTTGGGGGCATGGGG + Intergenic
936436820 2:112515215-112515237 CCCTGTGTATGGGCTGCATATGG + Intronic
941357654 2:164512716-164512738 AACTGTGTATGAGGGAAAGAAGG + Intronic
943446561 2:187994449-187994471 CACCGTGCTTCAGGGGCATAAGG + Intergenic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
946410301 2:219512183-219512205 AACTGGGTATAAGGGGCATGCGG - Intergenic
947100260 2:226613223-226613245 CAGTGGGCATGAGGGGCATGTGG - Intergenic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG + Exonic
1175791550 20:61743448-61743470 CAGTGGGCATGAGGGGCATGAGG - Intronic
1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG + Intergenic
1176901701 21:14450088-14450110 CACAGTGGATGAGAGTCATATGG - Intergenic
1179455198 21:41494470-41494492 CACTGTCTACGAGGTGCATCCGG - Exonic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG + Intergenic
951858117 3:27220793-27220815 CACTGTGTGAGACTGGCATAAGG + Intronic
953194546 3:40720232-40720254 GAATTTGTCTGAGGGGCATAAGG - Intergenic
953259335 3:41322394-41322416 AAATTTGTCTGAGGGGCATAAGG - Intronic
953260752 3:41336796-41336818 CGCTGTGTATCTGGAGCATATGG + Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
954543039 3:51408593-51408615 CACTGTGCATGAGAGGCAGTAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG + Intronic
966270796 3:178103191-178103213 TCCTGTGTAGGAGGGACATATGG - Intergenic
971291094 4:25340363-25340385 GACTGTGTAAGAGTGGCATAGGG - Intronic
972411911 4:38803340-38803362 GAATTTGTGTGAGGGGCATAAGG - Intronic
975504693 4:75124945-75124967 CACTCTGTAAGAAGAGCATATGG - Intergenic
977456178 4:97262878-97262900 CTCTGTGTATGAAGGGCCCATGG - Intronic
982199019 4:152942067-152942089 GACTGTGTATAAGGGACATGTGG + Intronic
982810114 4:159814630-159814652 CAGTGTGTATGTGGAGAATAGGG + Intergenic
985198204 4:187455921-187455943 CAGAGTGTATGAGGGGCTGATGG + Intergenic
985319122 4:188689161-188689183 TGATGTGTATGGGGGGCATATGG + Intergenic
997728214 5:136140437-136140459 CACAGTGTACGAGGGGGAAAAGG - Intronic
999652093 5:153777681-153777703 CAGTGTGTGTGAGGGGGATGAGG - Intronic
999875421 5:155800280-155800302 CACTGTGTTTTAGGAGAATATGG - Intergenic
1001178597 5:169496824-169496846 CACTTTGTTTGGGTGGCATAAGG + Intergenic
1002399765 5:178985118-178985140 CAGTGTGGATGAGAGGCACAGGG - Intronic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1016126707 6:140412397-140412419 GACTTTGATTGAGGGGCATAAGG - Intergenic
1016543490 6:145194274-145194296 CTATGTGTATGAGTGGCGTAGGG + Intergenic
1019157210 6:170047321-170047343 CACAGTGCATGTGGGGCATGGGG + Intergenic
1026383168 7:69819584-69819606 CACAGTGGATCAGAGGCATATGG + Intronic
1030397530 7:109006258-109006280 CACTGTGTAAATGGGGCACATGG + Intergenic
1032239887 7:130152650-130152672 CAATGTGTATGCGTGGTATATGG - Intergenic
1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG + Intronic
1035038801 7:155912772-155912794 TACTGTGTATGATGAGCATGTGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1041731652 8:61068937-61068959 CACTGTGGAAGAGGGACAAATGG - Intronic
1042002848 8:64145720-64145742 CACTTTGAAGGAGGGGCAAATGG + Intergenic
1045605422 8:103768355-103768377 CACTTTTTATGAGAAGCATATGG + Intronic
1046566090 8:115903420-115903442 CACCTTGTAAGAGGGGAATATGG - Intergenic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1048488970 8:134874293-134874315 CACAGTGTAAGAGGGCCATGTGG - Intergenic
1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG + Intronic
1057121857 9:92583008-92583030 CACTGTGTTTGACAGGCACATGG + Intronic
1057855752 9:98599629-98599651 TACTGTGTCTGAGGGGCCTGGGG - Intronic
1186559008 X:10590418-10590440 CACTGTGGAAGAGTGGCACAGGG - Intronic
1190957876 X:55213927-55213949 CACTGTGAATGAGGAGCCTCTGG + Intronic
1194234175 X:91361663-91361685 GAATATGAATGAGGGGCATAAGG + Intergenic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1198757902 X:140000497-140000519 CAATCTGACTGAGGGGCATAAGG + Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic
1201437702 Y:13977362-13977384 CACTGTGCTTGAGGGAAATAAGG + Intergenic