ID: 1038003860

View in Genome Browser
Species Human (GRCh38)
Location 8:23413500-23413522
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038003858_1038003860 1 Left 1038003858 8:23413476-23413498 CCTCATACACAGTGAGTTTCCTC 0: 1
1: 0
2: 1
3: 24
4: 187
Right 1038003860 8:23413500-23413522 ACTATTTTCATCTTGCATTTCGG No data
1038003857_1038003860 2 Left 1038003857 8:23413475-23413497 CCCTCATACACAGTGAGTTTCCT 0: 1
1: 0
2: 2
3: 13
4: 184
Right 1038003860 8:23413500-23413522 ACTATTTTCATCTTGCATTTCGG No data
1038003856_1038003860 3 Left 1038003856 8:23413474-23413496 CCCCTCATACACAGTGAGTTTCC 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1038003860 8:23413500-23413522 ACTATTTTCATCTTGCATTTCGG No data
1038003855_1038003860 10 Left 1038003855 8:23413467-23413489 CCATATGCCCCTCATACACAGTG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1038003860 8:23413500-23413522 ACTATTTTCATCTTGCATTTCGG No data
1038003854_1038003860 11 Left 1038003854 8:23413466-23413488 CCCATATGCCCCTCATACACAGT 0: 1
1: 0
2: 0
3: 18
4: 180
Right 1038003860 8:23413500-23413522 ACTATTTTCATCTTGCATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr