ID: 1038005044

View in Genome Browser
Species Human (GRCh38)
Location 8:23422861-23422883
Sequence CCGTCAGACGGAGCTGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038005044_1038005047 0 Left 1038005044 8:23422861-23422883 CCGAGAGCAGCTCCGTCTGACGG No data
Right 1038005047 8:23422884-23422906 AAATATACTGTGAGCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038005044 Original CRISPR CCGTCAGACGGAGCTGCTCT CGG (reversed) Intronic