ID: 1038005044

View in Genome Browser
Species Human (GRCh38)
Location 8:23422861-23422883
Sequence CCGTCAGACGGAGCTGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038005044_1038005047 0 Left 1038005044 8:23422861-23422883 CCGAGAGCAGCTCCGTCTGACGG 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1038005047 8:23422884-23422906 AAATATACTGTGAGCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038005044 Original CRISPR CCGTCAGACGGAGCTGCTCT CGG (reversed) Intronic
900131819 1:1090483-1090505 CCCTCAGCCGCTGCTGCTCTGGG - Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
905324114 1:37138380-37138402 CAGACAGATGGAGCTGCTCCTGG - Intergenic
907075263 1:51572478-51572500 CCGTCACACTAAGCTCCTCTAGG + Intergenic
907755233 1:57304460-57304482 CCGTGAGACGGTGATGCTCATGG - Intronic
914998530 1:152565851-152565873 GCGTCAGATGGGGCTGTTCTTGG + Exonic
1076836318 10:133022858-133022880 CCGTCAGCCGCGGCGGCTCTGGG + Intergenic
1076878882 10:133230483-133230505 CCGGGAGACGGAGCTGCTGCTGG + Exonic
1082219738 11:49619886-49619908 CCTTCAGACAGAGCTCTTCTTGG - Intergenic
1082724129 11:56714792-56714814 CCAGCAGACAGAGCTGCTCAGGG - Intergenic
1083259922 11:61517384-61517406 CGGGCAGAAGGAGCTGCTCCCGG + Intronic
1083890162 11:65592004-65592026 CCTCCAGTAGGAGCTGCTCTCGG - Exonic
1084520687 11:69660906-69660928 CCTTCAGACAGAGCAGTTCTAGG - Intronic
1094427586 12:30331385-30331407 CTTTCAGACTGAGCTACTCTAGG + Intergenic
1101991855 12:109492401-109492423 CCATCGGACAGACCTGCTCTAGG - Intronic
1102886007 12:116522318-116522340 CCATCAGACTGAGCTGACCTTGG + Intergenic
1113697547 13:112356753-112356775 CTGGAAGGCGGAGCTGCTCTGGG - Intergenic
1113801658 13:113089763-113089785 GCCTCACACGGAGCTGCTCACGG + Intronic
1124609324 15:31197506-31197528 CCCTCAGACCCAGCTGCTCCAGG - Intergenic
1130191300 15:81738588-81738610 CCCTGAGAAGGAGCTGTTCTTGG + Intergenic
1132626018 16:891928-891950 CCGTCAGCTGAACCTGCTCTCGG + Intronic
1133128761 16:3663573-3663595 GGGTCTGATGGAGCTGCTCTTGG - Exonic
1137585136 16:49659791-49659813 CCGTCAGCCTGAGCTGGGCTGGG - Intronic
1143755628 17:9065276-9065298 CCGTCCGACGGAGCCACTCTGGG - Intronic
1151434777 17:74088295-74088317 CAGGCAGGCGGAGCTGCCCTTGG - Intergenic
1151750192 17:76032762-76032784 CCGCCAGACTGTGCTCCTCTAGG - Intergenic
1152713983 17:81889498-81889520 CCCTCAGACCCAGGTGCTCTTGG - Intronic
1157882183 18:51330978-51331000 CCTTCAGAGAGAGCTGCTCTGGG - Intergenic
1166719454 19:44988799-44988821 CCTTCAGACTGGGGTGCTCTGGG - Intronic
925920160 2:8632751-8632773 CCCTCAGCTGGAGCTGCTCCAGG - Intergenic
928884664 2:36134700-36134722 CCCTCAGACGTAGATGCTCCTGG + Intergenic
935808724 2:106774363-106774385 CCATTGGACAGAGCTGCTCTAGG + Intergenic
948404172 2:237705025-237705047 CTGTCAGACCCCGCTGCTCTCGG - Intronic
1175813789 20:61873159-61873181 CCGTCAGATGGAGCACATCTGGG - Intronic
1179988305 21:44932913-44932935 CCCGCAGACTGAGCTGCGCTTGG - Intronic
1180228563 21:46412929-46412951 GCTGCAGTCGGAGCTGCTCTTGG + Exonic
1180245043 21:46541367-46541389 CTCTCAGAGTGAGCTGCTCTGGG + Intronic
1183286870 22:36971926-36971948 CTGTCAGACGGAGCAGCTGGGGG - Intergenic
1183522341 22:38302872-38302894 CCTCAAGACGGTGCTGCTCTTGG - Exonic
1184158308 22:42683471-42683493 CCATCAGACCGAGCTCCTCCAGG - Intergenic
1184192916 22:42907039-42907061 CCTTCCTAGGGAGCTGCTCTGGG - Intronic
1184723715 22:46331056-46331078 CCTTGAGAAGAAGCTGCTCTGGG + Intronic
954609771 3:51938095-51938117 CTTGCTGACGGAGCTGCTCTAGG + Exonic
961182405 3:124887112-124887134 CCGTGAGCCGGAGCTGCGCGCGG - Exonic
963982561 3:151556063-151556085 CAGTCTGACGGAACTGCTCTAGG + Intergenic
967210666 3:187165423-187165445 CAGTCAGACAGAGCTGAACTTGG - Intronic
985634192 5:1027945-1027967 CCGACAGACGGGGTGGCTCTGGG + Intronic
987061727 5:14249802-14249824 CCATCAAATGAAGCTGCTCTGGG - Intronic
992201908 5:74393247-74393269 CTGTCAGCCAGGGCTGCTCTCGG + Intergenic
1020337083 7:7070371-7070393 CCGACCGACCGAGCTGGTCTCGG - Intergenic
1033588611 7:142792403-142792425 CTGTCAGAGGAAGCTGGTCTGGG + Intergenic
1033989305 7:147264566-147264588 CCCTCTGATGGAGCTGCTCCAGG + Intronic
1035270978 7:157719664-157719686 CCGGCATACAGAGCTCCTCTTGG - Intronic
1035752221 8:2003718-2003740 CAGTGAGACGGAGCTGCTCTAGG - Exonic
1035767649 8:2119847-2119869 CCTTCACAGGGAGCTGCCCTGGG - Intronic
1035910365 8:3558937-3558959 CCGTCATACTGGGCTACTCTGGG - Intronic
1036642300 8:10592075-10592097 CAGGCAGAGGCAGCTGCTCTTGG - Intergenic
1038005044 8:23422861-23422883 CCGTCAGACGGAGCTGCTCTCGG - Intronic
1043012109 8:74893867-74893889 CCCACAGACGTAGCTACTCTGGG - Intergenic
1045573342 8:103392588-103392610 CAGTCAGAATCAGCTGCTCTGGG - Intergenic
1050148628 9:2597009-2597031 CAGTGAGATGGAGCTGCTTTAGG - Intergenic
1056806920 9:89736177-89736199 CTGTCAGCAGGGGCTGCTCTCGG + Intergenic
1062198331 9:135287030-135287052 CCTTGGGCCGGAGCTGCTCTGGG - Intergenic
1203661303 Un_KI270753v1:46085-46107 CTGTCAGCAGGGGCTGCTCTGGG + Intergenic
1185633644 X:1535855-1535877 AAGGCAGAGGGAGCTGCTCTGGG - Intronic
1189350752 X:40273806-40273828 CTGTCGGACAGCGCTGCTCTGGG - Intergenic
1189425341 X:40895450-40895472 CCTGCAGACGTAGGTGCTCTGGG - Intergenic
1198725112 X:139668395-139668417 CCGTGAGATGGAACTGCTCCAGG - Intronic