ID: 1038005047

View in Genome Browser
Species Human (GRCh38)
Location 8:23422884-23422906
Sequence AAATATACTGTGAGCCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038005044_1038005047 0 Left 1038005044 8:23422861-23422883 CCGAGAGCAGCTCCGTCTGACGG No data
Right 1038005047 8:23422884-23422906 AAATATACTGTGAGCCACACAGG No data
1038005043_1038005047 21 Left 1038005043 8:23422840-23422862 CCACACTTTGAGAAGCAAGTACC No data
Right 1038005047 8:23422884-23422906 AAATATACTGTGAGCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038005047 Original CRISPR AAATATACTGTGAGCCACAC AGG Intronic