ID: 1038005047 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:23422884-23422906 |
| Sequence | AAATATACTGTGAGCCACAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1038005044_1038005047 | 0 | Left | 1038005044 | 8:23422861-23422883 | CCGAGAGCAGCTCCGTCTGACGG | No data | ||
| Right | 1038005047 | 8:23422884-23422906 | AAATATACTGTGAGCCACACAGG | No data | ||||
| 1038005043_1038005047 | 21 | Left | 1038005043 | 8:23422840-23422862 | CCACACTTTGAGAAGCAAGTACC | No data | ||
| Right | 1038005047 | 8:23422884-23422906 | AAATATACTGTGAGCCACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1038005047 | Original CRISPR | AAATATACTGTGAGCCACAC AGG | Intronic | ||