ID: 1038005595

View in Genome Browser
Species Human (GRCh38)
Location 8:23427253-23427275
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038005592_1038005595 -2 Left 1038005592 8:23427232-23427254 CCAATTAGAAGCCTGAGAGAACA 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG No data
1038005591_1038005595 -1 Left 1038005591 8:23427231-23427253 CCCAATTAGAAGCCTGAGAGAAC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr