ID: 1038006309

View in Genome Browser
Species Human (GRCh38)
Location 8:23433263-23433285
Sequence CTGCAACCCTACCTCTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038006303_1038006309 5 Left 1038006303 8:23433235-23433257 CCCAGGCCCCAGAGCTGCACTTT 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG 0: 1
1: 0
2: 0
3: 21
4: 134
1038006307_1038006309 -2 Left 1038006307 8:23433242-23433264 CCCAGAGCTGCACTTTAGGAACT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG 0: 1
1: 0
2: 0
3: 21
4: 134
1038006308_1038006309 -3 Left 1038006308 8:23433243-23433265 CCAGAGCTGCACTTTAGGAACTG 0: 1
1: 0
2: 3
3: 19
4: 175
Right 1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG 0: 1
1: 0
2: 0
3: 21
4: 134
1038006304_1038006309 4 Left 1038006304 8:23433236-23433258 CCAGGCCCCAGAGCTGCACTTTA 0: 1
1: 0
2: 5
3: 30
4: 343
Right 1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG 0: 1
1: 0
2: 0
3: 21
4: 134
1038006306_1038006309 -1 Left 1038006306 8:23433241-23433263 CCCCAGAGCTGCACTTTAGGAAC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG 0: 1
1: 0
2: 0
3: 21
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038006309 Original CRISPR CTGCAACCCTACCTCTGAAA TGG Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902663625 1:17922342-17922364 TTGCAGCCCTCCCTCTGGAATGG + Intergenic
903186989 1:21634434-21634456 CTGCCTCCTTATCTCTGAAATGG - Intronic
904748958 1:32729032-32729054 CTGCAGCCCCACCTCAGAAATGG + Intergenic
905256963 1:36691027-36691049 CTCCCACCATACCTCTGAAACGG + Intergenic
907670107 1:56466900-56466922 CTGAAACCCTAACTCTTAATGGG - Intergenic
914341658 1:146765163-146765185 CTGCGCCCCTCCTTCTGAAAGGG + Intergenic
915524037 1:156465358-156465380 CTGCAGCCCTACCTCTGCCAAGG - Exonic
919573056 1:199272195-199272217 CTGCAATCCTAGCTCTCAAGTGG + Intergenic
919956174 1:202418679-202418701 CCGCCACCCCACCTCTGCAATGG - Intronic
1063551480 10:7038046-7038068 CTGCAACCCTACAGAGGAAAAGG + Intergenic
1063994273 10:11603212-11603234 CTGGAAACCTACCTGTGGAAGGG - Intronic
1067096016 10:43300653-43300675 CTGGAAACCCACCCCTGAAACGG + Intergenic
1068113932 10:52715417-52715439 TTGAAACCCAACATCTGAAATGG - Intergenic
1068546108 10:58347192-58347214 CTAGATCCCTCCCTCTGAAAGGG - Intronic
1070462606 10:76684875-76684897 CAGCAACCCCAGCTTTGAAATGG - Intergenic
1075329085 10:121559659-121559681 CAGCAACTCTGCCCCTGAAATGG - Intronic
1080103546 11:28486959-28486981 CTGCAAACCGACCTTTAAAAAGG + Intergenic
1080921259 11:36711573-36711595 ATGCAACCCTGCTTCAGAAAGGG - Intergenic
1081106822 11:39080103-39080125 TTGCAACCATACATCTGACAAGG + Intergenic
1086061324 11:82702570-82702592 CTGCAACACCACCTCTGCTAGGG + Intergenic
1086633908 11:89059416-89059438 CAGCATCCCTTCCTCTGCAAAGG - Intronic
1086807546 11:91263785-91263807 CTGCAAACCTCCCTCTGAACAGG - Intergenic
1088723528 11:112614872-112614894 CATCAACCCTCCCTCTGACAGGG - Intergenic
1088723765 11:112617099-112617121 CATCAACCCTCCCTCTGACAGGG - Intergenic
1094277721 12:28697227-28697249 CTGCATCCATACTACTGAAAAGG + Intergenic
1097236109 12:57540760-57540782 CTGCACCCCTCCTTTTGAAATGG - Intronic
1097820137 12:64120422-64120444 CTGCAAACCTACCTGAGAACTGG + Intronic
1097925139 12:65118949-65118971 CTGCACCCTTCCATCTGAAAGGG - Intronic
1100853977 12:98741872-98741894 CTGCAGCCCTCCCTCTCAAGTGG - Intronic
1101616860 12:106346133-106346155 CTGCAAAGCTACCTTGGAAAGGG + Intronic
1102600349 12:114025035-114025057 CTGCATCCCTACTTATGAAGGGG - Intergenic
1102970577 12:117162936-117162958 CTGAAACCCTTCCTCTGGAGAGG + Intronic
1105592569 13:21808012-21808034 TTGCAACCATATCTCTGATAAGG + Intergenic
1106504604 13:30360341-30360363 CCACAACCCCACCCCTGAAATGG - Intergenic
1107419746 13:40235142-40235164 CTGCAGTTCTACCTCTGGAATGG - Intergenic
1107577449 13:41742205-41742227 CTCCAATCCTGTCTCTGAAATGG - Intronic
1112866626 13:103909164-103909186 CTGTAATCCTACTTGTGAAAGGG - Intergenic
1112934161 13:104778397-104778419 CTGCATCCATACCTCTGGTATGG + Intergenic
1113222106 13:108116788-108116810 CTGCAGCTCTACCTCTGGAGAGG - Intergenic
1113241046 13:108337502-108337524 CCTTAACCCTTCCTCTGAAATGG + Intergenic
1116373908 14:44172764-44172786 CTGCAGCCCTGCCTAGGAAATGG + Intergenic
1118352119 14:64979749-64979771 CTGCAACTCTCCCTGTGGAAGGG + Intronic
1120081088 14:80217007-80217029 CTACACCATTACCTCTGAAATGG - Intronic
1120358526 14:83464583-83464605 CTGAAACACTAGCCCTGAAATGG + Intergenic
1122128083 14:99589972-99589994 GTGCAACCCAACCTCTGAGCAGG - Intronic
1127567672 15:60208733-60208755 ATGCAACCATTCCCCTGAAATGG - Intergenic
1129466988 15:75729698-75729720 CTGCAGGCCAACCTCTGAATAGG + Intergenic
1129720251 15:77874053-77874075 CTGCAGGCCAACCTCTGAATAGG - Intergenic
1132051696 15:98612780-98612802 TTGAGACCTTACCTCTGAAATGG + Intergenic
1132768109 16:1545225-1545247 CTCCAACACGACCTCTGACAAGG + Intronic
1135089896 16:19505322-19505344 CTGCAATCCTATCTTTAAAATGG + Intronic
1139327120 16:66161189-66161211 CTGCACCCCCACCTCTCCAAAGG + Intergenic
1139992620 16:70952279-70952301 CTGCGCCCCTCCTTCTGAAAGGG - Intronic
1142224192 16:88869669-88869691 TTGCAATCCTGCCTCTGACAGGG - Intergenic
1146578480 17:34014721-34014743 CTGCTTCCTTATCTCTGAAATGG + Intronic
1150493718 17:65591928-65591950 CTGTAACCCTAGCTCTGAGTAGG - Intronic
1152265159 17:79289925-79289947 CTCCAACCCTACCCCTAAAATGG + Intronic
1203162990 17_GL000205v2_random:68792-68814 TTGCAGCCCTACCACTGAAAAGG + Intergenic
1158085462 18:53645937-53645959 CTGGAACGCTACGACTGAAATGG - Intergenic
1160350002 18:78170033-78170055 CTGCACTCCTACCTATTAAAGGG + Intergenic
1160567600 18:79797021-79797043 CTGCACTGCTGCCTCTGAAAGGG - Intergenic
1160723051 19:605528-605550 CTGGGTCCCCACCTCTGAAAGGG - Intronic
1160723071 19:605580-605602 CTGGGTCCCCACCTCTGAAAGGG - Intronic
1167484999 19:49757576-49757598 CTGCTTCCCTACCTGTGAAATGG + Intronic
928425686 2:31175799-31175821 CTGCAACCCTTCCTCTGCTATGG - Intronic
929750900 2:44712508-44712530 ATGGAGCCCTACCTCTGAACGGG + Intronic
935303989 2:101719147-101719169 CTGCAACCCTAGCTCTGACTAGG - Intronic
936403472 2:112183319-112183341 CTGTAAGTCCACCTCTGAAAGGG + Intronic
939836203 2:147132578-147132600 CTGCAAACATACATTTGAAAAGG + Intergenic
943052675 2:182935696-182935718 CTGAAACCCTATTTCAGAAAAGG + Intronic
943903499 2:193470778-193470800 TTTCAAACCTACATCTGAAAAGG + Intergenic
944297357 2:198081748-198081770 CTAAAACCCTACCCATGAAAAGG - Intronic
1170307003 20:14949402-14949424 CTAAAACCCTGCCTCTGAAGGGG - Intronic
1170525398 20:17230850-17230872 CTATAACTTTACCTCTGAAAAGG + Intronic
1172890818 20:38262591-38262613 CTGAAAGCCTAGATCTGAAAGGG + Intronic
1174366379 20:50059077-50059099 CTCCCACCCCACCTCTGAACTGG + Intergenic
1175839117 20:62015462-62015484 CTGCATCCCCACCTCTGTCATGG - Intronic
1176338846 21:5624057-5624079 TTGCAGCCCTACCACTGAAAAGG - Intergenic
1176340254 21:5687130-5687152 TTGCAGCCCTACCACTGAAAAGG - Intergenic
1176472508 21:7119283-7119305 TTGCAGCCCTACCACTGAAAAGG - Intergenic
1176504573 21:7637326-7637348 TTGCAGCCCTACCACTGAAAAGG + Intergenic
1176944888 21:14967544-14967566 CTGCAAACCTATCTCTGATGAGG + Exonic
1179156972 21:38859283-38859305 CTGCAACCCCACCTCTCGAGGGG - Intergenic
1183135412 22:35882363-35882385 TTGCAACCACACCACTGAAAGGG - Intronic
1203239518 22_KI270733v1_random:1588-1610 TTGCAGCCCTACCACTGAAAAGG - Intergenic
949092814 3:49524-49546 ATGCAATACTACCTCTCAAAAGG - Intergenic
950008677 3:9706958-9706980 CTTCCACCTTTCCTCTGAAACGG + Intronic
950333192 3:12173587-12173609 CTCCAACCATCCCACTGAAATGG + Intronic
952187355 3:30984408-30984430 CTAGAACCCTGCCTCTCAAAGGG - Intergenic
953341709 3:42140061-42140083 AATCAACCCTACCTCTGAGAAGG - Intronic
960023127 3:112977880-112977902 CTGCAACACTTCATCTTAAATGG - Intergenic
960620240 3:119630256-119630278 CTACTACCCTACCTGTGAAGAGG + Intergenic
961550985 3:127670642-127670664 CTGCAACCTGAACTCAGAAAGGG + Intronic
962680635 3:137796163-137796185 CTCAAACCCCACCACTGAAACGG - Intergenic
964621033 3:158720352-158720374 CTGCAAACCTTCCTCTGGAAGGG + Intronic
973702797 4:53553447-53553469 CTCCACCCCTACTTCTGATATGG + Intronic
977632408 4:99257757-99257779 CTTCATCCCTATCTCTGCAAAGG + Intergenic
978480437 4:109184063-109184085 ATGCTTTCCTACCTCTGAAATGG - Intronic
980004115 4:127521534-127521556 CTGCAAGCCTAGCAATGAAAAGG - Intergenic
980210269 4:129778568-129778590 CTGCAAGCCTTGGTCTGAAAGGG + Intergenic
987692365 5:21283456-21283478 CTGGAAACCCACCCCTGAAACGG + Intergenic
988236098 5:28547419-28547441 CTGCAATCAATCCTCTGAAATGG + Intergenic
989230985 5:39086297-39086319 CTGCAGCCCTGCCTCTGAGAAGG - Intergenic
990014925 5:51048400-51048422 CTGCTTCCTTACCTCTAAAATGG - Intergenic
991799568 5:70346442-70346464 CTGGAAACCCACCCCTGAAACGG - Intergenic
991829029 5:70663596-70663618 CTGGAAACCCACCCCTGAAACGG + Intergenic
991891927 5:71345871-71345893 CTGGAAACCCACCCCTGAAACGG - Intergenic
993868510 5:93222695-93222717 CTGGGACCCTTCCTCTGGAATGG + Intergenic
996576916 5:124985754-124985776 GAGCATCCCTACCTCTGAAGAGG + Intergenic
996853665 5:127980516-127980538 CTGCAAGCCTCCCTCATAAAAGG + Intergenic
996874042 5:128222187-128222209 CTGGAAACCCACCCCTGAAATGG + Intergenic
997931721 5:138078027-138078049 CTGGAACCCTGAATCTGAAAGGG + Intergenic
998705849 5:144759223-144759245 CTGTGATCCTAGCTCTGAAAAGG - Intergenic
1001364513 5:171123124-171123146 CAGCAACCCTACCAGTGGAAGGG - Intronic
1001727498 5:173918449-173918471 CAGCAACCCCAAATCTGAAAGGG - Intronic
1003137089 6:3441897-3441919 CTGCAGCACTGCCTCTGAAGGGG + Intronic
1007753692 6:44085008-44085030 CAGCAACCCTACCCCAGAAATGG + Intergenic
1007911039 6:45514361-45514383 CTGCCTCCCTACCTGTGAAATGG - Intronic
1012061642 6:94491664-94491686 CTGCAAACTTAGGTCTGAAATGG + Intergenic
1012540936 6:100360811-100360833 CAGCAACCCTATCTATGATAAGG + Intergenic
1013651445 6:112199171-112199193 CTGCACGCCCACCTCTGACAAGG - Intronic
1016997553 6:149970929-149970951 CTGCACCCATAGCTCTGAATGGG - Intronic
1017001247 6:149999247-149999269 CTGCACCCATAGCTCTGAATGGG + Intergenic
1017010969 6:150063766-150063788 CTGCACCCATAGCTCTGAATGGG + Intronic
1020061210 7:5153939-5153961 GTGAGACCCTGCCTCTGAAAAGG - Intergenic
1020472012 7:8548147-8548169 CTTCAACACTTCATCTGAAAAGG - Intronic
1020604326 7:10317104-10317126 TTGCAACCATACATCTGATAAGG + Intergenic
1021083590 7:16392519-16392541 ATGCAATCCTTGCTCTGAAAGGG + Intronic
1022049645 7:26653452-26653474 CTGCAGTCTTGCCTCTGAAAGGG - Intergenic
1023742029 7:43289449-43289471 CTGGAACCCAACCCCTGTAAGGG - Intronic
1024881906 7:54096324-54096346 CTGCATCCCTACCTGTGAGGCGG - Intergenic
1030100456 7:105940962-105940984 CTGGAACCCTAACTCTAAGATGG + Intronic
1034393296 7:150801793-150801815 CTGCCAGCCTCCCTCTGAACAGG + Intronic
1036225006 8:6950217-6950239 CTGTAACCCTACGTCTTAAAAGG + Intergenic
1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG + Intronic
1039380059 8:37076597-37076619 CTGCAGCCCTGCCTGGGAAATGG + Intergenic
1044831786 8:96257260-96257282 TTGTAACCTTACCTCTTAAAAGG - Intronic
1046145238 8:110149821-110149843 CTCCAACCATGTCTCTGAAAAGG + Intergenic
1047323516 8:123813111-123813133 ATGGAACTCTTCCTCTGAAAAGG + Exonic
1049769291 8:144372450-144372472 CGGCAACCTTTCCTCTGTAATGG - Intergenic
1049952710 9:660745-660767 CAGCAACTCTACCACTGGAAGGG + Intronic
1051200982 9:14623580-14623602 CTGCAACTATACATCTGACAAGG + Intronic
1052802133 9:32978570-32978592 CAGCAACACTATCTGTGAAATGG + Intronic
1057359663 9:94361446-94361468 CAGCATCTCTACCTGTGAAATGG + Intergenic
1057663681 9:97026645-97026667 CAGCATCTCTACCTGTGAAATGG - Intergenic
1058717557 9:107736575-107736597 CTGCAACCCAGCTTCTGCAAGGG + Intergenic
1059044525 9:110851411-110851433 CTGAAACCCTTCCTCTTAAATGG + Intergenic
1203422813 Un_GL000195v1:10863-10885 TTGCAGCCCTACCACTGAAAAGG + Intergenic
1189354381 X:40299830-40299852 CTGCCTCCTGACCTCTGAAATGG - Intergenic
1189855667 X:45222904-45222926 TTGCAACCATACGTCTGATAAGG - Intergenic
1192504029 X:71670112-71670134 CTCCAACCCTCCCTCTGGGACGG - Intergenic
1195665610 X:107427547-107427569 CTGCATCCATATCCCTGAAAAGG - Intergenic
1195925683 X:110022385-110022407 CTGAAAACCTATCCCTGAAAAGG - Intronic
1197071583 X:122305209-122305231 CTACACTCCTTCCTCTGAAATGG - Intergenic
1202578427 Y:26352503-26352525 CCGCCACCCCACCTCTGCAATGG + Intergenic