ID: 1038010383

View in Genome Browser
Species Human (GRCh38)
Location 8:23471245-23471267
Sequence GGGATTTTACAGATTGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038010383_1038010389 14 Left 1038010383 8:23471245-23471267 CCTTAATCAATCTGTAAAATCCC No data
Right 1038010389 8:23471282-23471304 GTAATGTATTATAGGATCCAAGG No data
1038010383_1038010384 -8 Left 1038010383 8:23471245-23471267 CCTTAATCAATCTGTAAAATCCC No data
Right 1038010384 8:23471260-23471282 AAAATCCCCTTTGTTATGTAAGG No data
1038010383_1038010388 6 Left 1038010383 8:23471245-23471267 CCTTAATCAATCTGTAAAATCCC No data
Right 1038010388 8:23471274-23471296 TATGTAAGGTAATGTATTATAGG No data
1038010383_1038010390 20 Left 1038010383 8:23471245-23471267 CCTTAATCAATCTGTAAAATCCC No data
Right 1038010390 8:23471288-23471310 TATTATAGGATCCAAGGATTAGG No data
1038010383_1038010392 26 Left 1038010383 8:23471245-23471267 CCTTAATCAATCTGTAAAATCCC No data
Right 1038010392 8:23471294-23471316 AGGATCCAAGGATTAGGTCAGGG No data
1038010383_1038010391 25 Left 1038010383 8:23471245-23471267 CCTTAATCAATCTGTAAAATCCC No data
Right 1038010391 8:23471293-23471315 TAGGATCCAAGGATTAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038010383 Original CRISPR GGGATTTTACAGATTGATTA AGG (reversed) Intergenic
No off target data available for this crispr