ID: 1038015741

View in Genome Browser
Species Human (GRCh38)
Location 8:23513084-23513106
Sequence TCTTACATTTAGAATGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038015735_1038015741 18 Left 1038015735 8:23513043-23513065 CCCTGTAGCTTGGTGCTGTCTCT No data
Right 1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG No data
1038015736_1038015741 17 Left 1038015736 8:23513044-23513066 CCTGTAGCTTGGTGCTGTCTCTG No data
Right 1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG No data
1038015734_1038015741 23 Left 1038015734 8:23513038-23513060 CCATGCCCTGTAGCTTGGTGCTG No data
Right 1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038015741 Original CRISPR TCTTACATTTAGAATGTGGC AGG Intergenic
No off target data available for this crispr