ID: 1038018407

View in Genome Browser
Species Human (GRCh38)
Location 8:23533434-23533456
Sequence GTGCTTCCCAAACCTTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038018406_1038018407 -7 Left 1038018406 8:23533418-23533440 CCTGGAAGGGAGGAATGTGCTTC 0: 1
1: 0
2: 1
3: 22
4: 210
Right 1038018407 8:23533434-23533456 GTGCTTCCCAAACCTTTTCCTGG No data
1038018401_1038018407 18 Left 1038018401 8:23533393-23533415 CCTGGGGTGGGGGATGTGCGTGT 0: 1
1: 0
2: 1
3: 35
4: 352
Right 1038018407 8:23533434-23533456 GTGCTTCCCAAACCTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038018407 Original CRISPR GTGCTTCCCAAACCTTTTCC TGG Intronic
No off target data available for this crispr