ID: 1038021064

View in Genome Browser
Species Human (GRCh38)
Location 8:23552185-23552207
Sequence TGGTTTTCTCCCTACCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038021060_1038021064 -1 Left 1038021060 8:23552163-23552185 CCATTTTGATTAACCTAGGTGGT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1038021064 8:23552185-23552207 TGGTTTTCTCCCTACCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038021064 Original CRISPR TGGTTTTCTCCCTACCAGGT AGG Intronic
No off target data available for this crispr