ID: 1038021610

View in Genome Browser
Species Human (GRCh38)
Location 8:23555846-23555868
Sequence CAGGGTGACCTGAACGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038021601_1038021610 0 Left 1038021601 8:23555823-23555845 CCACTTTCTCCCCCCTCCAACAT 0: 1
1: 0
2: 2
3: 55
4: 714
Right 1038021610 8:23555846-23555868 CAGGGTGACCTGAACGCTGAAGG No data
1038021600_1038021610 30 Left 1038021600 8:23555793-23555815 CCTTTATGGTTTGTTCTCACACA 0: 1
1: 0
2: 0
3: 20
4: 207
Right 1038021610 8:23555846-23555868 CAGGGTGACCTGAACGCTGAAGG No data
1038021605_1038021610 -10 Left 1038021605 8:23555833-23555855 CCCCCTCCAACATCAGGGTGACC 0: 1
1: 1
2: 11
3: 94
4: 929
Right 1038021610 8:23555846-23555868 CAGGGTGACCTGAACGCTGAAGG No data
1038021604_1038021610 -9 Left 1038021604 8:23555832-23555854 CCCCCCTCCAACATCAGGGTGAC 0: 1
1: 1
2: 2
3: 22
4: 305
Right 1038021610 8:23555846-23555868 CAGGGTGACCTGAACGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038021610 Original CRISPR CAGGGTGACCTGAACGCTGA AGG Intronic
No off target data available for this crispr