ID: 1038022432

View in Genome Browser
Species Human (GRCh38)
Location 8:23561711-23561733
Sequence GGGTCTAGATGGTCACTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038022425_1038022432 3 Left 1038022425 8:23561685-23561707 CCCAGGCAGAGGGCTGGGGCTGG No data
Right 1038022432 8:23561711-23561733 GGGTCTAGATGGTCACTTAGTGG No data
1038022421_1038022432 10 Left 1038022421 8:23561678-23561700 CCTACTGCCCAGGCAGAGGGCTG No data
Right 1038022432 8:23561711-23561733 GGGTCTAGATGGTCACTTAGTGG No data
1038022427_1038022432 2 Left 1038022427 8:23561686-23561708 CCAGGCAGAGGGCTGGGGCTGGA No data
Right 1038022432 8:23561711-23561733 GGGTCTAGATGGTCACTTAGTGG No data
1038022420_1038022432 11 Left 1038022420 8:23561677-23561699 CCCTACTGCCCAGGCAGAGGGCT No data
Right 1038022432 8:23561711-23561733 GGGTCTAGATGGTCACTTAGTGG No data
1038022416_1038022432 23 Left 1038022416 8:23561665-23561687 CCAGGGGTAATTCCCTACTGCCC No data
Right 1038022432 8:23561711-23561733 GGGTCTAGATGGTCACTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038022432 Original CRISPR GGGTCTAGATGGTCACTTAG TGG Intronic