ID: 1038022503

View in Genome Browser
Species Human (GRCh38)
Location 8:23562135-23562157
Sequence TCTTGGGGATGAGCCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038022503_1038022510 7 Left 1038022503 8:23562135-23562157 CCAGCCAGGGCTCATCCCCAAGA 0: 1
1: 0
2: 1
3: 33
4: 255
Right 1038022510 8:23562165-23562187 CTGCCATTCTCCAAAGTGTGGGG No data
1038022503_1038022509 6 Left 1038022503 8:23562135-23562157 CCAGCCAGGGCTCATCCCCAAGA 0: 1
1: 0
2: 1
3: 33
4: 255
Right 1038022509 8:23562164-23562186 ACTGCCATTCTCCAAAGTGTGGG No data
1038022503_1038022511 8 Left 1038022503 8:23562135-23562157 CCAGCCAGGGCTCATCCCCAAGA 0: 1
1: 0
2: 1
3: 33
4: 255
Right 1038022511 8:23562166-23562188 TGCCATTCTCCAAAGTGTGGGGG No data
1038022503_1038022514 23 Left 1038022503 8:23562135-23562157 CCAGCCAGGGCTCATCCCCAAGA 0: 1
1: 0
2: 1
3: 33
4: 255
Right 1038022514 8:23562181-23562203 TGTGGGGGCCTCTCCCCTGAAGG No data
1038022503_1038022508 5 Left 1038022503 8:23562135-23562157 CCAGCCAGGGCTCATCCCCAAGA 0: 1
1: 0
2: 1
3: 33
4: 255
Right 1038022508 8:23562163-23562185 CACTGCCATTCTCCAAAGTGTGG No data
1038022503_1038022515 24 Left 1038022503 8:23562135-23562157 CCAGCCAGGGCTCATCCCCAAGA 0: 1
1: 0
2: 1
3: 33
4: 255
Right 1038022515 8:23562182-23562204 GTGGGGGCCTCTCCCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038022503 Original CRISPR TCTTGGGGATGAGCCCTGGC TGG (reversed) Intronic
900139314 1:1132863-1132885 CCGTGAGGATGAGCCCTGGCCGG - Intergenic
901153693 1:7121769-7121791 TGTTGGTGCTGAGGCCTGGCTGG + Intronic
901264419 1:7899181-7899203 TGTTGGAGATGAGGCCTGGTGGG - Intergenic
901463209 1:9404122-9404144 TCCTGGGCATGGGCCCTTGCCGG - Intergenic
901662375 1:10806588-10806610 TGGTGGGAAAGAGCCCTGGCTGG - Intergenic
901943872 1:12685107-12685129 TGTTGGGGATGGGACCTGGTGGG - Intergenic
902210581 1:14901695-14901717 TTTTGGGGATGTGACCTGGATGG - Intronic
902757128 1:18556283-18556305 CCTTGGAGAAGTGCCCTGGCTGG - Intergenic
904497492 1:30895430-30895452 TCTGGGAGCTGAGCCCTGGCTGG - Intronic
905969069 1:42127190-42127212 TCATGGGTCTGAGCCTTGGCTGG + Intergenic
907320664 1:53600137-53600159 GCTTGGGGGTGAGCCCGGGGCGG + Exonic
909664055 1:78114244-78114266 TCTTGGGGCTGAGCTATGACAGG - Intronic
913536969 1:119782400-119782422 TCTTGGGGGTCAGCCCTGCCTGG + Intergenic
913646217 1:120857349-120857371 CCTGGGGGAATAGCCCTGGCTGG + Intergenic
914080428 1:144405533-144405555 CCTGGGGGAATAGCCCTGGCTGG - Intergenic
914175335 1:145274057-145274079 CCTGGGGGAATAGCCCTGGCTGG - Intergenic
914530057 1:148515536-148515558 CCTGGGGGAATAGCCCTGGCTGG - Intergenic
914919057 1:151835328-151835350 GCCTGGGGAACAGCCCTGGCTGG - Intergenic
915905312 1:159872792-159872814 TCAGAGGGATGAGCCCTGGGTGG + Intronic
916169179 1:161987857-161987879 CCCTGCGGATGAGCCCAGGCAGG + Intronic
916497127 1:165356245-165356267 CCTCGGGGAGGAGCCCCGGCTGG + Intronic
916714766 1:167439530-167439552 TCCTGGGGCTGAGCCCTTGCAGG + Intronic
916745383 1:167681075-167681097 TCTTGGGGATGAATCGGGGCTGG - Intronic
917578210 1:176346206-176346228 TGTTGGAGATGAGGCCTGGTGGG - Intergenic
919987516 1:202686105-202686127 TGTTGGAGATGTGGCCTGGCGGG + Intronic
922445957 1:225697595-225697617 TGTTGGCCATCAGCCCTGGCAGG - Intergenic
922701404 1:227763314-227763336 TCTTGGGGGTAAGGCCTGCCTGG + Intronic
923787473 1:237081895-237081917 ACTTGGCGATGATCCCTGGGAGG + Intronic
924225086 1:241915343-241915365 TGTTGGAGATGAGGCCTGGCAGG - Intergenic
924945593 1:248844693-248844715 CCTTGGGCATGTGCCCTGGGAGG + Intronic
1064330174 10:14386314-14386336 GGTTGGGAAAGAGCCCTGGCTGG + Intronic
1065319406 10:24495236-24495258 TGCCTGGGATGAGCCCTGGCTGG + Intronic
1066253072 10:33652944-33652966 TGTTGGGGGTGAGGCCTGGTAGG - Intergenic
1066357919 10:34702657-34702679 TTGGGGGGATAAGCCCTGGCTGG - Intronic
1067084732 10:43231761-43231783 TGCTGGGGCTGAGCCCTGCCAGG + Intronic
1069564907 10:69457320-69457342 GCTTGGGGCAGAGGCCTGGCTGG + Intronic
1069841124 10:71340059-71340081 TCATGGTGCTCAGCCCTGGCTGG - Intronic
1069912395 10:71767530-71767552 CCTGGGGGATGGGGCCTGGCGGG - Intronic
1069954789 10:72043353-72043375 TGTTTGGGGTGAGCTCTGGCAGG + Intergenic
1070641804 10:78175687-78175709 TGTTGGAGATGAGGCCTGGTGGG + Intergenic
1071179904 10:82971207-82971229 TTTTGGAGATGAGGCCTGGTGGG - Intronic
1072362845 10:94676852-94676874 TATTGGGGATGGGGCCTGGTGGG + Intergenic
1073351244 10:102821601-102821623 TCTTGGAGGTGAAGCCTGGCTGG - Intergenic
1075762089 10:124864689-124864711 GCTTCGGGATGATTCCTGGCTGG - Intergenic
1075808311 10:125205855-125205877 TCTTGGTGAGGAGTCCTTGCAGG + Intergenic
1075838496 10:125476858-125476880 TGTTGGAGATGAGGCCTGGTGGG - Intergenic
1076190135 10:128477120-128477142 TCTTGAGAATGAGCCCTGGAGGG - Intergenic
1076809298 10:132878428-132878450 TGTTGGGGATGTACCCAGGCAGG + Intronic
1076871340 10:133196454-133196476 TCCTGGGGAGGAGCCGTGTCTGG + Intronic
1077019065 11:409503-409525 TCAGGGTGATGAGCCCTAGCGGG + Intronic
1077415850 11:2423962-2423984 GCTTGAGGACAAGCCCTGGCAGG + Intergenic
1077432057 11:2520572-2520594 CCCTGGGGAACAGCCCTGGCAGG + Intronic
1077550407 11:3197621-3197643 CCTTGGGCAGGAGCCCAGGCTGG + Intergenic
1078575264 11:12496646-12496668 TCTTGGGGAAGCCCCATGGCAGG - Intronic
1079177053 11:18152182-18152204 TCCTGGGGATTAGCCCAAGCAGG + Intronic
1081369107 11:42276824-42276846 TGTTGGAGGTGAGCCCTGGTGGG - Intergenic
1081667412 11:44924628-44924650 GTTTTGGGATCAGCCCTGGCAGG - Intronic
1081907655 11:46679717-46679739 TCTTGAGGATGACTGCTGGCAGG + Exonic
1082779641 11:57276892-57276914 TCTTCTGCATGACCCCTGGCAGG - Intergenic
1086339971 11:85838718-85838740 TGCTGGAGATGAGCCCTGGTGGG - Intergenic
1086729181 11:90227246-90227268 TCTTGGAGATGGGGCCTGGTGGG - Intergenic
1090456063 11:126850695-126850717 TTTTGGGGATAAGCAGTGGCTGG - Intronic
1092879778 12:12879046-12879068 TCTTGGGGTTGTGCCTAGGCTGG + Intergenic
1094424213 12:30301910-30301932 TCTTGCTGATGGGCCCTGACAGG - Intergenic
1095409788 12:41909134-41909156 TGTTGGAGGTGAGGCCTGGCAGG + Intergenic
1096997175 12:55845939-55845961 TCTAGGGGCTGAGGCCAGGCAGG - Intergenic
1097265346 12:57741158-57741180 TCCTGTGGTGGAGCCCTGGCAGG - Intronic
1101395276 12:104341768-104341790 TTATGGGAATGAGCCCTTGCAGG - Intronic
1102266477 12:111490574-111490596 TGTTGGGGATGATCACTGGAAGG - Intronic
1102725796 12:115063541-115063563 TGTTGGGGATGGGGCCTGGTTGG + Intergenic
1103921122 12:124399696-124399718 CCCTGAGAATGAGCCCTGGCAGG + Intronic
1104044547 12:125152585-125152607 TTTTGGGGATGCTCACTGGCAGG + Intergenic
1104264563 12:127219541-127219563 TCTTTAGGATAAGGCCTGGCTGG - Intergenic
1104430527 12:128712514-128712536 TCTTAGGGATGAGCCATGTGAGG + Intergenic
1104646192 12:130499220-130499242 TGTTGGGGAAGAGACCTGGTGGG - Intronic
1108527943 13:51301711-51301733 TGTTGGAGGTGAGGCCTGGCGGG - Intergenic
1108676469 13:52741161-52741183 CCCCAGGGATGAGCCCTGGCTGG - Intergenic
1110515540 13:76408138-76408160 TGTTGGAGATGAGGCCTGGTGGG - Intergenic
1111659764 13:91194287-91194309 TGTTGGAGGTGAGGCCTGGCGGG + Intergenic
1111902252 13:94213656-94213678 TCATGTGGATGAGCCGGGGCTGG - Intronic
1112314879 13:98351893-98351915 TGTTGGGGGTGGGTCCTGGCGGG - Intronic
1112357474 13:98686039-98686061 TATTTGGGAACAGCCCTGGCTGG + Intronic
1112992849 13:105535008-105535030 TGTTGGAGATGAGGCCTGGTGGG + Intergenic
1113679735 13:112234844-112234866 TGTTGGAGGTGAGGCCTGGCCGG + Intergenic
1116252029 14:42498740-42498762 TGTTGGAGATGGGGCCTGGCAGG + Intergenic
1118004668 14:61554591-61554613 ACATGGGTAAGAGCCCTGGCTGG + Intronic
1120203948 14:81567729-81567751 TCTTGGGGAAGATCCCTGGGAGG - Intergenic
1121880171 14:97492856-97492878 TCTTGCGGAAGAGCCATGCCTGG + Intergenic
1122861481 14:104584515-104584537 TTTTGGGGATGCTGCCTGGCAGG - Intronic
1123044029 14:105502836-105502858 CCTTGGGGCTGAGCCCCGGCGGG - Intergenic
1124158138 15:27246115-27246137 TGTTGGAGACGAGGCCTGGCGGG - Intronic
1125510836 15:40291560-40291582 TCTCGGGGATGAGCCTGGGGCGG - Intronic
1126886388 15:53155592-53155614 TCTAGTGGATGGGCCTTGGCAGG + Intergenic
1127259986 15:57320445-57320467 TCATGGGGAGGAAACCTGGCTGG - Intergenic
1128449507 15:67796576-67796598 TGTTGGGGATGGGGCCTGGTAGG - Intronic
1128715276 15:69903357-69903379 TCTTGGTGATGGGGCCTGTCAGG + Intergenic
1129253081 15:74319335-74319357 GGTGGGGGAAGAGCCCTGGCTGG - Intronic
1130225639 15:82056426-82056448 TGTAGGGGATGAGCCATGGATGG - Intergenic
1131225424 15:90621025-90621047 TGTTGGGCATGCGTCCTGGCAGG - Intronic
1132869825 16:2110966-2110988 GCTCGGGGACGAGGCCTGGCTGG - Exonic
1134117006 16:11556520-11556542 TATTGGGGATGGGCGCTGGCTGG + Exonic
1134909637 16:18013026-18013048 TCTTTGGGATGGGAACTGGCTGG - Intergenic
1135008203 16:18847547-18847569 GCTCTGGGATGAGCTCTGGCTGG - Exonic
1135850600 16:25959736-25959758 TGTTGGGGATGGGGCCTGGTGGG + Intronic
1137446931 16:48537622-48537644 ACTTGGAGATAAGACCTGGCTGG + Intergenic
1138177362 16:54912806-54912828 CATTGGGGTTGATCCCTGGCAGG - Intergenic
1139351534 16:66339289-66339311 TGTTGGAGGTGAGGCCTGGCGGG + Intergenic
1141412810 16:83846932-83846954 TCTTGGAGAAGACCCCTGGTAGG - Intergenic
1141426880 16:83949851-83949873 TCTGTGGGTTCAGCCCTGGCAGG - Intronic
1142183361 16:88682373-88682395 TCCTGGGGAGGAGCCCAGCCGGG - Intronic
1142290897 16:89193199-89193221 GCTTGGGGAAGAGGCGTGGCTGG - Intronic
1142415022 16:89936552-89936574 TCTCGGGGCTGGGCCCTGGGAGG + Intergenic
1145244866 17:21262117-21262139 TGTGGGGGATGAACCCTGGAGGG + Intergenic
1148615706 17:48998234-48998256 ACACGGGGATGACCCCTGGCTGG + Intronic
1148682060 17:49479839-49479861 TTTTCTGGCTGAGCCCTGGCTGG + Intergenic
1150436760 17:65160017-65160039 TCCTGGGGATAAGACCTGGGAGG + Intronic
1151426114 17:74032167-74032189 TCCTGGGGCTCAGCCCTGGGAGG - Intergenic
1153171376 18:2319787-2319809 TGTTGGAGATGAGTCCTGGTGGG + Intergenic
1157701546 18:49764160-49764182 TGTGGGGAATGAGGCCTGGCAGG + Intergenic
1157761508 18:50268651-50268673 TCTTGGTGCTCAGCACTGGCCGG - Intronic
1158129856 18:54140377-54140399 TGTTGGGGAAGGGACCTGGCAGG + Intergenic
1158768029 18:60479206-60479228 TGTTGGGGATGAGGCCAGGTGGG - Intergenic
1159763132 18:72453529-72453551 TATTGGAGATGGGTCCTGGCGGG + Intergenic
1160932035 19:1575436-1575458 TCTTGGGGCTGAGACATGGGCGG + Intronic
1161235476 19:3196115-3196137 TGCTGGGGATGCCCCCTGGCTGG + Intronic
1163007544 19:14406168-14406190 TGTTGGGGGTGGGCCCTGGGGGG + Intronic
1164099971 19:22045914-22045936 TCTGTGGGCTGAGCCCAGGCAGG + Intergenic
1164100117 19:22047389-22047411 TCTGTGGGTTGAGCCCAGGCAGG + Intergenic
1164119459 19:22252843-22252865 TCTGTGGGCTGAGCCCAGGCAGG + Intergenic
1164180780 19:22816625-22816647 TCTGTGGGCTGAGCCCAGGCAGG - Intergenic
1165801373 19:38552740-38552762 CCTGGGGGCTGGGCCCTGGCTGG + Intronic
1166252079 19:41578077-41578099 TCTGGGGGCTGAGCCCTGCCTGG - Intronic
1166255608 19:41602053-41602075 TCTGGGGGCTGAGCCCTGGCTGG - Intronic
1166281719 19:41798489-41798511 TCTTGGGGCTGGACCCTGGCTGG - Intronic
1166415578 19:42592986-42593008 TCTGGGGTCTAAGCCCTGGCTGG + Intronic
1166432310 19:42738175-42738197 TCTGAGGGCTGAGCCCTGGCTGG + Intronic
1166435429 19:42763364-42763386 TCTGAGGGCTGAGCCCTGGCTGG + Intronic
1166445294 19:42853396-42853418 TCTGAGGGCTGAGCCCTAGCTGG + Intronic
1166448288 19:42877360-42877382 TCTGAGGGCTGAGCCCTGGCTGG + Intronic
1166452692 19:42915572-42915594 TCTGAGGACTGAGCCCTGGCTGG + Intronic
1166455178 19:42934853-42934875 TCTGAGGGCTGAGCCCTGGCTGG + Intronic
1166464970 19:43024139-43024161 TCTGAGGGCTGAGCCCTGGCTGG + Intronic
1166471097 19:43080328-43080350 TCTGAGGGCTGAGCCCTAGCTGG + Intronic
1166482251 19:43184231-43184253 TCTGAGGGCTGAGCCCTGGCTGG + Intronic
1166484733 19:43203336-43203358 TCTGAGGGCTGAGCCCTGGCTGG + Intronic
1166491854 19:43267232-43267254 TCTGAGGGCTGAGCCCTGGCTGG + Intronic
1166495834 19:43302618-43302640 TCTTGGGGCTGAACCCTGCCTGG + Intergenic
1167159218 19:47756435-47756457 GCATGGGGCTGAGCCCTGCCAGG + Intronic
1167373732 19:49100348-49100370 GCTTGGGGAAGAGCCCTGGAAGG - Intronic
1168125439 19:54280061-54280083 GCTTGGGGATGGTCCCTGGAAGG + Exonic
1168169042 19:54574293-54574315 GCTTGGGGAGGTGCCCTGGAAGG - Exonic
1168176543 19:54631492-54631514 GCTTGGGGAGGTGCCCTGGAAGG - Exonic
926133654 2:10321328-10321350 AGTTGGGGATGAGGCCTGGTGGG - Intronic
928001981 2:27531362-27531384 TGTTGGGGATGGGGCCTGGTGGG + Intergenic
929113439 2:38424611-38424633 TGTTGGGGAAGAGACCTGGTAGG - Intergenic
930943758 2:57046185-57046207 TATTGGGCAAGTGCCCTGGCTGG + Intergenic
931560049 2:63551320-63551342 TGTTGGAGATGGGGCCTGGCGGG + Intronic
934474940 2:94587517-94587539 TTTGGGGAAGGAGCCCTGGCTGG + Intergenic
936756899 2:115725002-115725024 TGTTGGAGATGAGGCCTGGTGGG - Intronic
936889990 2:117358340-117358362 TGTTGGAGATGAGGCCTGGTGGG + Intergenic
937251668 2:120527792-120527814 GCCTGGGGATGAGTCCTGGGTGG + Intergenic
937571310 2:123365659-123365681 TCTTGGGAATCAGCACTGGGAGG + Intergenic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
938459778 2:131490073-131490095 TCTTGGGCCTGAGCTCTGGGTGG + Intronic
939229250 2:139405770-139405792 TTTTGGAGATGAGGCCTGGTGGG - Intergenic
939428612 2:142073706-142073728 TGTTGGAGATGAGGCCTGGTGGG + Intronic
941578864 2:167269407-167269429 TCTTGTGGATGAGACCTGCTGGG + Intergenic
941630021 2:167874164-167874186 TCTTGGGGATGAGCTCTGAATGG - Intergenic
943290250 2:186061974-186061996 TCTTGGGAATGTGCACTGGAAGG - Intergenic
945356408 2:208844250-208844272 TCTTGGGGGAGGGCCCTGGTGGG + Intronic
946188920 2:217996927-217996949 TCTTGGGGATTGGGACTGGCAGG - Intronic
946312592 2:218891197-218891219 GCCTGGGGATGAACCCTGCCTGG - Intronic
946968404 2:225065186-225065208 TGTTGGGGAAGAGACCTGGTAGG - Intergenic
947873202 2:233451016-233451038 TCTTGGTGTTGAGCGCAGGCAGG - Exonic
947982889 2:234425438-234425460 TATTGGGAATGAGGCCGGGCAGG + Intergenic
948773783 2:240269484-240269506 CCTTGAGGTTAAGCCCTGGCTGG + Intergenic
949059497 2:241948924-241948946 TGTGGGGGTTGATCCCTGGCTGG + Intergenic
1169120892 20:3095009-3095031 TCTTAGGGGTGAGCTTTGGCTGG - Intergenic
1171092692 20:22300901-22300923 TCACAGGGATGAGCTCTGGCTGG - Intergenic
1172121897 20:32603408-32603430 TCTTGGGACTGATCCCTGCCAGG + Intronic
1172290151 20:33770251-33770273 TCTTGGGGCTGTGCTGTGGCAGG - Exonic
1174185367 20:48702550-48702572 TTTCGAGGATGTGCCCTGGCAGG - Intronic
1175790439 20:61737134-61737156 CCTGGGGGCTGAGCCCTGCCTGG + Intronic
1175928062 20:62480545-62480567 CCTTGAGGAGCAGCCCTGGCAGG + Intergenic
1179101813 21:38360986-38361008 TGCTGGGCATGAGCCCAGGCAGG - Intergenic
1179998649 21:44985289-44985311 GCTTTGGGATGAGCTCTGGCAGG + Intergenic
1180064044 21:45404258-45404280 CATAGGAGATGAGCCCTGGCCGG + Intergenic
1180153566 21:45965792-45965814 TGTTGGAGATGAGGCCTGGTGGG + Intergenic
1180163339 21:46007592-46007614 GCTTGGGGATGAACCAAGGCTGG - Intergenic
1181392598 22:22594616-22594638 ACTGGGGGCTGAGCCCTGGGAGG - Intergenic
1181404507 22:22673200-22673222 TTTGGGGGCTGAGCCCTGGGAGG - Intergenic
1181413099 22:22738763-22738785 TTTGGGGGCTGAGCCCTGGGAGG - Intronic
1181425886 22:22838451-22838473 TTATGGGGCTGAGCCCTGGAAGG - Intronic
1182301195 22:29338049-29338071 TCTTGGGGGTGTGCCCTAGGTGG + Intronic
1183804566 22:40197244-40197266 TCTTTGGGAGCATCCCTGGCTGG + Intronic
1184600918 22:45542814-45542836 TCCTGGGGAGGAGGACTGGCAGG + Intronic
950273507 3:11639161-11639183 ACCTGGGTCTGAGCCCTGGCTGG - Intronic
952428596 3:33200527-33200549 TCTAGGAGATGAGACCAGGCTGG + Intronic
953660407 3:44887638-44887660 TCTTGGGGGTGGCCCATGGCTGG + Intronic
954214561 3:49117160-49117182 TCTTGGCGCTGGGCCCTGCCTGG + Exonic
954629334 3:52039684-52039706 TCTTGGGGACCAGGACTGGCTGG + Intergenic
955564884 3:60233392-60233414 TCTTGGGGAGGAGCCCTCTAAGG - Intronic
960988047 3:123293081-123293103 TTCTGGGGCTGCGCCCTGGCAGG + Intronic
961244595 3:125440526-125440548 TCTGGGGGACATGCCCTGGCTGG - Intergenic
963003784 3:140707185-140707207 TGTTGGAGATGAGGCCTGGTGGG - Intergenic
964652527 3:159027551-159027573 TGTTGGAGATGAGGCCTGGTGGG + Intronic
968089507 3:195891663-195891685 TCCTGAGGCTGAGCCCTGGAGGG - Intronic
969492228 4:7505980-7506002 TCATTGTGAGGAGCCCTGGCAGG + Intronic
969552958 4:7883981-7884003 TGTTGGGGATGGGGCCTGGCTGG + Intronic
974196708 4:58584971-58584993 TCATGGAGAAGAGCTCTGGCTGG - Intergenic
976015122 4:80543005-80543027 CCTTGAGGTTGAGCCCTGGCTGG - Intronic
976754397 4:88482690-88482712 TCTGGGGGAAGAGGCTTGGCTGG + Intronic
977518891 4:98056276-98056298 GCTTGGGGATGGGTACTGGCTGG - Intronic
981107658 4:140899507-140899529 TCTGGGTGATGAGCCAAGGCTGG + Intronic
985785220 5:1889767-1889789 TCTTGGCCAGGAGGCCTGGCAGG + Intergenic
988786740 5:34572109-34572131 TGTTTAGGATGAGCACTGGCAGG - Intergenic
989645533 5:43628227-43628249 TCTTGGTGCTGAGCCCTTGGAGG + Exonic
993174177 5:84460944-84460966 TGTTGGGGTTGAGGCCTGACAGG - Intergenic
994246073 5:97478625-97478647 TTTTGGAAAAGAGCCCTGGCTGG + Intergenic
995403721 5:111769852-111769874 TGTTGGGGAAGAGACCTGGTAGG - Intronic
998880547 5:146640916-146640938 GCTTGGGGATGAGGGCTGGGTGG - Intronic
1001890917 5:175337792-175337814 TATTGGAGGTGAGGCCTGGCGGG + Intergenic
1006638180 6:35474925-35474947 TCCTGGGCCTGAGGCCTGGCAGG + Exonic
1007044656 6:38760635-38760657 TGTTGGAGATGGGGCCTGGCAGG + Intronic
1007212053 6:40201305-40201327 TGTTGGAGGTGGGCCCTGGCGGG + Intergenic
1007251455 6:40497936-40497958 TCTTGGGGAACAGCCCTGAGAGG + Intronic
1007274455 6:40663084-40663106 TCTTGTGGATGAGCCTGGGGGGG - Intergenic
1014254580 6:119148205-119148227 TCCTGGGAAGGAGCCCAGGCAGG + Intronic
1014886210 6:126784674-126784696 CCTTGTGGATGAGGGCTGGCAGG - Intergenic
1018635069 6:165854079-165854101 TCCTAGGGAAGAGCCCAGGCAGG + Intronic
1019340065 7:504671-504693 TCGTGGGGATGGGCTCGGGCAGG + Intronic
1019454809 7:1121352-1121374 TCTTGGGGCTGAGTGGTGGCTGG - Intronic
1019607309 7:1916654-1916676 CCTGGGGGATGATCACTGGCGGG + Intronic
1019779243 7:2929873-2929895 TGGTGGGGATGAGCTCTGGAGGG + Intronic
1019910878 7:4100017-4100039 TCTGGGGCATGAGGCCTGGCTGG - Intronic
1021583100 7:22177744-22177766 TCTTGCTGAGGAGCCCTGGGTGG - Intronic
1022717910 7:32915327-32915349 TGTTGGAGATGAGGCCTGGTGGG - Intergenic
1024529992 7:50383686-50383708 GCTTGGAGAAGGGCCCTGGCTGG - Intronic
1024839642 7:53570834-53570856 TGTTGGAGGTGGGCCCTGGCAGG + Intergenic
1026653677 7:72237627-72237649 TCTTGGGGCTGAGTTCTGGGAGG + Intronic
1026869371 7:73841296-73841318 TGTTGGGGATCAAGCCTGGCTGG + Intronic
1029498072 7:100908726-100908748 TGTTGGAGATGAGCCCTGGTTGG + Intergenic
1031468715 7:122144394-122144416 TCTTGGGGAGGAGCAGGGGCCGG - Intergenic
1032526547 7:132582081-132582103 TCTTGGGGTTAAGTCCTGGGAGG + Intronic
1033027731 7:137792633-137792655 TGTTGGAGATGGGGCCTGGCAGG + Intronic
1033087883 7:138358950-138358972 TCTTGGGTATGTGGCCCGGCAGG - Intergenic
1033429924 7:141280046-141280068 TCTAGAGGATGAGCCCAGGAAGG - Intronic
1036146899 8:6262249-6262271 TCTTGGGGATGCACCCCAGCAGG + Intergenic
1036280992 8:7401464-7401486 TCTTGGAGGTGGGACCTGGCAGG + Intergenic
1036340473 8:7910108-7910130 TCTTGGAGGTGGGACCTGGCAGG - Intergenic
1038022503 8:23562135-23562157 TCTTGGGGATGAGCCCTGGCTGG - Intronic
1038424812 8:27458326-27458348 TCTTGTTGATGAGCTCTGCCAGG - Exonic
1039076099 8:33691788-33691810 TGTTGGAGATGAGGCCTGGTGGG + Intergenic
1039774720 8:40724000-40724022 CTTTGGGGAAGAGCCTTGGCTGG - Intronic
1041048243 8:53907644-53907666 TCTTGGGGATGAGGAGTGGCGGG + Intronic
1041279776 8:56198229-56198251 TCTCGGGGCTGAGCCTTGGAGGG - Intronic
1041660033 8:60392390-60392412 TGTTGGGGATGAAGCCTGGCGGG + Intergenic
1041671932 8:60500291-60500313 TGTTGGGGAAGAGACCTGGTGGG + Intergenic
1042723727 8:71850139-71850161 TATAGGGGATGAGCCATGGCTGG - Intronic
1045879487 8:107020968-107020990 CCTTAAGGTTGAGCCCTGGCTGG - Intergenic
1046588964 8:116182557-116182579 TGTTGGAGATGGGGCCTGGCAGG + Intergenic
1047026991 8:120835095-120835117 TGTTTGGGATGAGGCCTGGAAGG - Intergenic
1049452928 8:142672039-142672061 TTCTGGGGAGGGGCCCTGGCAGG - Intronic
1049870180 8:144968822-144968844 TCCTGGGGATGACCCATGGATGG + Intergenic
1050687313 9:8186330-8186352 TCTTGGTGATAAGCTCTGGCTGG - Intergenic
1051784222 9:20724114-20724136 TGTTGGAGATGAGGCCTGGTAGG - Intronic
1052577678 9:30311365-30311387 TGTTGGAGATGGGGCCTGGCAGG - Intergenic
1052823609 9:33159304-33159326 TCATGGGGAGGGTCCCTGGCAGG - Intronic
1055606379 9:77975097-77975119 TCTAGGGGATGGGCCCTGTAGGG - Intronic
1058572995 9:106367362-106367384 TGTTGGAGATGAGGCCTGGTGGG - Intergenic
1059499174 9:114736454-114736476 TTTTGGGTTTGAGCCCTGGGTGG - Intergenic
1060484483 9:124038457-124038479 TCCTGGGGAGGAGCCCAGGCTGG + Intergenic
1061682599 9:132250348-132250370 TCTTGGGAATTGGCCCTGCCTGG - Intergenic
1061892818 9:133631703-133631725 TCTTGGGGCTGAGGCCTGCTGGG - Intergenic
1061927015 9:133810940-133810962 ACTTGGGAATGAGCTCTGACTGG - Intronic
1062174093 9:135151400-135151422 GCTCGGGGAAGAGGCCTGGCTGG - Intergenic
1062324165 9:136004475-136004497 TCTTGGGGAGGAACCATGGTGGG - Intergenic
1062452000 9:136619719-136619741 TCTGGGGACTGAGCCCTGGCAGG + Intergenic
1062475004 9:136722442-136722464 CCCTGGGCATGAGCCCTGCCAGG + Intronic
1062531015 9:137000317-137000339 TCTGTGGGATGACCCCTGACAGG + Intergenic
1062617353 9:137403818-137403840 TCCTGGTGAAGAGCCCAGGCTGG - Intronic
1185745574 X:2570067-2570089 TGTTGGAGATGAGGCCTGGTGGG - Intergenic
1189308783 X:40006068-40006090 TCTTTAGGGTGCGCCCTGGCCGG - Intergenic
1190256974 X:48770763-48770785 TCTAGGGAATGAGCCTTGGGTGG + Intronic
1190776323 X:53555018-53555040 TTGTGGGGATGATCACTGGCTGG - Intronic
1193519952 X:82518055-82518077 TTTTGGGGAAGAGCCCTAGTGGG - Intergenic
1194541577 X:95178575-95178597 TGTTGGGGGAGAGACCTGGCGGG + Intergenic
1196263884 X:113618719-113618741 GCTTGGGTATCAGCCCAGGCGGG - Intergenic
1198074353 X:133180340-133180362 TGTTGGGGGTGAGACCTGGTGGG + Intergenic
1198388454 X:136149223-136149245 TCTTGGAGATGAGCTGAGGCAGG - Intronic