ID: 1038023421

View in Genome Browser
Species Human (GRCh38)
Location 8:23568974-23568996
Sequence GCTAATTCTGGCCGGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038023415_1038023421 15 Left 1038023415 8:23568936-23568958 CCATCTCAAAAGGAAAAAAAAAA No data
Right 1038023421 8:23568974-23568996 GCTAATTCTGGCCGGCATGGTGG No data
1038023414_1038023421 22 Left 1038023414 8:23568929-23568951 CCAGACTCCATCTCAAAAGGAAA No data
Right 1038023421 8:23568974-23568996 GCTAATTCTGGCCGGCATGGTGG No data
1038023412_1038023421 30 Left 1038023412 8:23568921-23568943 CCACAGAGCCAGACTCCATCTCA No data
Right 1038023421 8:23568974-23568996 GCTAATTCTGGCCGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038023421 Original CRISPR GCTAATTCTGGCCGGCATGG TGG Intronic