ID: 1038024023

View in Genome Browser
Species Human (GRCh38)
Location 8:23573232-23573254
Sequence CGGGTGACGCAGAGCAGACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038024023_1038024027 13 Left 1038024023 8:23573232-23573254 CCTTGTCTGCTCTGCGTCACCCG 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1038024027 8:23573268-23573290 CGCAGCCTCGCTTTCTGAAATGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038024023 Original CRISPR CGGGTGACGCAGAGCAGACA AGG (reversed) Exonic
900300464 1:1974333-1974355 TGGGTGACTCAGAGCGGAGATGG - Intronic
901206316 1:7497950-7497972 CGAGTGAGGCCCAGCAGACAAGG - Intronic
901325265 1:8361535-8361557 CTGGTGGTGCAGAGCAGACAGGG - Intronic
903605241 1:24570746-24570768 CTGGTGATGCAGACCACACATGG + Intronic
904834006 1:33323374-33323396 AGGGGGGCGCAGAGCAGAAAGGG + Intergenic
911809698 1:102260371-102260393 TGGCTGAAGCAGGGCAGACAAGG + Intergenic
912238821 1:107883242-107883264 CGGGTGCTGCAGAGCAAAGAGGG - Intronic
912475789 1:109933963-109933985 CGGGTGCCGGTGAGCAGGCAGGG + Intergenic
912552309 1:110492214-110492236 TGGGTGAAGCAGAGGGGACAAGG - Intergenic
915584324 1:156836045-156836067 CAGATGAAGCAGAGAAGACAAGG - Intronic
921422255 1:214961839-214961861 AGGGTGATGCAGAGCAGCCCAGG + Intergenic
924626806 1:245702414-245702436 ATGGAGACGCAGAGCAAACAGGG - Intronic
1067166342 10:43869106-43869128 GGGGTGGCTCAGAGCAGACAGGG + Intergenic
1071489926 10:86129286-86129308 AGTGTGACACAGAGCAGACTAGG - Intronic
1074527994 10:114278182-114278204 AGGGAGACGCAGAGCATCCAGGG - Intronic
1074558026 10:114509739-114509761 AGGCTGACGCAGAGCCCACATGG - Intronic
1076243895 10:128931597-128931619 CGGGTGACACAGGCCAGGCACGG - Intergenic
1077217753 11:1402131-1402153 TGGGTGCCGGAGAGCAGGCATGG + Intronic
1080443542 11:32316780-32316802 CAGGTAACGCAGAGCAAAGAGGG + Intergenic
1082637348 11:55612864-55612886 AGGGTGAGGTAGTGCAGACAGGG - Intergenic
1090712967 11:129404405-129404427 AGGGTGACACATAGCAGAGATGG + Intronic
1096451706 12:51748367-51748389 GGGGTGGGGCAGAGCAGGCAGGG - Intronic
1098485969 12:71022175-71022197 CGGGTGAGGCTGGGCAAACAAGG - Intergenic
1100639829 12:96471739-96471761 CCTGTGACACAGAGCAGAGAAGG + Intergenic
1102184970 12:110940910-110940932 TGGGTGGCTCAGAGCAGTCAGGG - Intergenic
1103205387 12:119125058-119125080 TGAGTGATGCAGAGGAGACATGG + Intronic
1103547423 12:121712331-121712353 CGGGCGGCGCAGCGCAGAGAGGG - Intergenic
1113031871 13:106002006-106002028 TGGCTAACGCAGAGCAGACTGGG - Intergenic
1113834328 13:113318910-113318932 GGTGGGACGCAGAGCAGCCAAGG - Intronic
1118015161 14:61653037-61653059 CGGCTAACGCAGAGCACACTGGG - Intronic
1122816734 14:104317674-104317696 CGGGTGAAGCAGAGCGTGCACGG - Intergenic
1122957285 14:105076641-105076663 GGGGTGACGCAGAGTGGGCAAGG + Intergenic
1123008186 14:105334355-105334377 AGGCTGACGCAGACCAGACCTGG + Intronic
1129972477 15:79790955-79790977 GGGGTGAAGCAGAGAAGAGATGG - Intergenic
1138329091 16:56198860-56198882 CTGGTGCTGCAGAGCAGGCAAGG - Intronic
1142966897 17:3587244-3587266 CAGGGGAGGCAGAGCAGACCAGG + Intronic
1144413752 17:15025817-15025839 CGGGTGACTCAAAGCAAAGAGGG - Intergenic
1144460455 17:15454544-15454566 GGGGTGAGGGAGAGCGGACATGG - Intronic
1144576679 17:16434029-16434051 GGGGGGACACAGAGCAGCCAGGG - Intronic
1151475123 17:74340839-74340861 GGGGTGAGGCGGAGCAGGCAGGG + Intronic
1152298269 17:79480910-79480932 CTGGAGACGCAGTGGAGACAAGG - Intronic
1152632658 17:81417476-81417498 CAAGTGACTCAGAGCAGCCATGG - Intronic
1152728008 17:81957130-81957152 GGGCTGACGCTGAGCAGACTCGG - Intronic
1153003668 18:478870-478892 CGGATGACTCACAGGAGACATGG - Intronic
1153945810 18:10016242-10016264 CTGGGGAGGCAGAGCAGAGATGG + Intergenic
1162793046 19:13072864-13072886 CGGGAGACCCAAAGCAGAGAAGG - Intronic
1162816577 19:13198960-13198982 CAGGTGAGGATGAGCAGACAGGG - Intergenic
1163268490 19:16235262-16235284 CGGGTGACCAAGCGCAGACGTGG - Exonic
926117994 2:10225391-10225413 CGGGTCACGCTGAGCTTACAGGG - Intergenic
927020315 2:19009984-19010006 GGGAGGTCGCAGAGCAGACATGG - Intergenic
929247430 2:39718334-39718356 CAGGTGACTCTGAGCAGCCAAGG - Intergenic
929782649 2:44967074-44967096 CTGGTGAAGGAGAGAAGACACGG + Intergenic
932825215 2:74932872-74932894 GGGCTGAGGCAGAGCACACAAGG - Intergenic
933894135 2:86795045-86795067 CGGGTGACACAGAGAAGAGAAGG - Intronic
935146343 2:100398146-100398168 CAGGTGACACAGAGCAGAAGAGG + Intronic
937520336 2:122706152-122706174 AGGGTGACCCAGAACAGAAAAGG - Intergenic
937904013 2:127043096-127043118 TGGGGGAGGCAGAGCAGCCACGG - Intergenic
939178947 2:138781832-138781854 CGGTTGAAGCAGAGCAGCCTTGG + Intergenic
946626025 2:221613138-221613160 CTGGAGACGCAGAGGAGAGAAGG + Intergenic
947589472 2:231377227-231377249 GGGGAGACCCAGAGAAGACAGGG + Intergenic
948915815 2:241034612-241034634 CGGCTCGCGCACAGCAGACATGG + Exonic
1175885293 20:62286826-62286848 CTGTTGTCCCAGAGCAGACAGGG + Intronic
1176084243 20:63288827-63288849 AGGGTCACACAGGGCAGACAAGG - Exonic
1176978661 21:15353728-15353750 CGTGTGACACAGACCAAACAGGG - Intergenic
1180934178 22:19613350-19613372 GGGGTGATGCAGAGCAGCCTTGG - Intergenic
1182583267 22:31327994-31328016 CGGGCAAGGCAGAGCAGCCAGGG - Intronic
1182906502 22:33942027-33942049 CTGGTTAAGCAGAGCAGAAAAGG - Intergenic
1183166099 22:36148491-36148513 CAGGTGACACAGAGAAGACGTGG + Intronic
1183748670 22:39706614-39706636 GGGGTGACGCTCAGCAGACCGGG + Intergenic
950575214 3:13828127-13828149 TGGGTGACTCAGACCAGTCAGGG + Intronic
951320713 3:21241213-21241235 AGGGTGAAGCAGTGTAGACATGG - Intergenic
955627633 3:60935608-60935630 CGGCTGAGGCAGGGAAGACAAGG + Intronic
963093037 3:141504573-141504595 GGGGAGGGGCAGAGCAGACACGG - Intronic
966834529 3:184038788-184038810 CTGGGGAGGCAGAGCTGACAGGG + Exonic
971512226 4:27440955-27440977 CAGGTGACTCAGAGGACACATGG + Intergenic
972240085 4:37181237-37181259 GGGGTAACGCAGAGAAGAAAGGG - Intergenic
982070381 4:151689064-151689086 CAGGTTACACACAGCAGACACGG - Intronic
986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG + Intergenic
997529534 5:134573387-134573409 CGGCTGAGCCAGAGCAGCCAGGG - Intronic
1004322012 6:14639256-14639278 CGGGTGTCACAGAGCAGCCCCGG - Intergenic
1006554950 6:34858177-34858199 TGCCTGACGCAGAGAAGACAAGG - Exonic
1007115340 6:39339368-39339390 AGTGTCACGCAGAGCAGAGATGG + Intronic
1010542325 6:77107200-77107222 TGTGTGACTCAGAGCAGCCAAGG - Intergenic
1014261737 6:119226320-119226342 AGGGTGACGCACAGCAGCCTGGG + Intronic
1017906591 6:158760939-158760961 CGGGTGACCAGAAGCAGACAAGG + Intronic
1018663550 6:166112770-166112792 CGGGTGACTCATAGCTTACACGG + Intergenic
1033447467 7:141435839-141435861 CGGGTCAGCCAGGGCAGACAAGG + Intronic
1034969522 7:155410413-155410435 CAGGTGACGCAGGGCAGGAAGGG - Intergenic
1035004452 7:155644776-155644798 CGGGTGACGGAGGACAGAGAAGG - Exonic
1035245891 7:157561758-157561780 AGGGTGGTGGAGAGCAGACAAGG - Intronic
1036657990 8:10690274-10690296 CGAGTGACCCAGAGCATGCATGG + Intronic
1036782853 8:11661705-11661727 TGGGTGATGCATAGCAGACGGGG - Intergenic
1038024023 8:23573232-23573254 CGGGTGACGCAGAGCAGACAAGG - Exonic
1043274549 8:78376958-78376980 CAGCTGAGACAGAGCAGACAGGG - Intergenic
1057878305 9:98774251-98774273 GTGTTGGCGCAGAGCAGACATGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1187037244 X:15553752-15553774 CAGATGAAGAAGAGCAGACAAGG + Intronic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1198961445 X:142187696-142187718 CGTGTGAGGCAGAGCAGGGAGGG - Intergenic