ID: 1038024825

View in Genome Browser
Species Human (GRCh38)
Location 8:23578962-23578984
Sequence AGGACCTGGCATATAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038024816_1038024825 29 Left 1038024816 8:23578910-23578932 CCAGAAGGAAATGCAATATTGGT No data
Right 1038024825 8:23578962-23578984 AGGACCTGGCATATAGGCCAAGG No data
1038024814_1038024825 30 Left 1038024814 8:23578909-23578931 CCCAGAAGGAAATGCAATATTGG No data
Right 1038024825 8:23578962-23578984 AGGACCTGGCATATAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038024825 Original CRISPR AGGACCTGGCATATAGGCCA AGG Intergenic
No off target data available for this crispr