ID: 1038028133

View in Genome Browser
Species Human (GRCh38)
Location 8:23610432-23610454
Sequence TAAGAGGTACACTTAAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038028133_1038028140 21 Left 1038028133 8:23610432-23610454 CCCCATCTTAAGTGTACCTCTTA No data
Right 1038028140 8:23610476-23610498 AAATGGGCGAGTCTTCTCCCTGG No data
1038028133_1038028137 4 Left 1038028133 8:23610432-23610454 CCCCATCTTAAGTGTACCTCTTA No data
Right 1038028137 8:23610459-23610481 TACCAGAACACACTTTAAAATGG No data
1038028133_1038028138 5 Left 1038028133 8:23610432-23610454 CCCCATCTTAAGTGTACCTCTTA No data
Right 1038028138 8:23610460-23610482 ACCAGAACACACTTTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038028133 Original CRISPR TAAGAGGTACACTTAAGATG GGG (reversed) Intergenic
No off target data available for this crispr