ID: 1038029820

View in Genome Browser
Species Human (GRCh38)
Location 8:23628103-23628125
Sequence TTATTCCAATTCAAGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038029814_1038029820 18 Left 1038029814 8:23628062-23628084 CCAACTGTCTACAAGCTGGCAGC No data
Right 1038029820 8:23628103-23628125 TTATTCCAATTCAAGCTCAAAGG No data
1038029818_1038029820 -5 Left 1038029818 8:23628085-23628107 CCAGGAAAACCAGTGGCATTATT No data
Right 1038029820 8:23628103-23628125 TTATTCCAATTCAAGCTCAAAGG No data
1038029817_1038029820 -4 Left 1038029817 8:23628084-23628106 CCCAGGAAAACCAGTGGCATTAT No data
Right 1038029820 8:23628103-23628125 TTATTCCAATTCAAGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038029820 Original CRISPR TTATTCCAATTCAAGCTCAA AGG Intergenic
No off target data available for this crispr