ID: 1038032252

View in Genome Browser
Species Human (GRCh38)
Location 8:23652743-23652765
Sequence CAGTAGCCATTCAAGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038032249_1038032252 20 Left 1038032249 8:23652700-23652722 CCAAGTAGGATGTTGGAAAATAC No data
Right 1038032252 8:23652743-23652765 CAGTAGCCATTCAAGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038032252 Original CRISPR CAGTAGCCATTCAAGAATGG TGG Intergenic
No off target data available for this crispr