ID: 1038034739

View in Genome Browser
Species Human (GRCh38)
Location 8:23677665-23677687
Sequence CGCTGGAACCCGAGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038034739_1038034746 9 Left 1038034739 8:23677665-23677687 CCTCCGCCTCTCGGGTTCCAGCG No data
Right 1038034746 8:23677697-23677719 TCTCAGCCTCCGGAGTAGCTGGG 0: 259
1: 18469
2: 235304
3: 279876
4: 165733
1038034739_1038034748 17 Left 1038034739 8:23677665-23677687 CCTCCGCCTCTCGGGTTCCAGCG No data
Right 1038034748 8:23677705-23677727 TCCGGAGTAGCTGGGATTACAGG 0: 2061
1: 108024
2: 251521
3: 227196
4: 155976
1038034739_1038034743 -1 Left 1038034739 8:23677665-23677687 CCTCCGCCTCTCGGGTTCCAGCG No data
Right 1038034743 8:23677687-23677709 GATTCTCCTGTCTCAGCCTCCGG 0: 183
1: 3179
2: 6710
3: 4423
4: 3201
1038034739_1038034745 8 Left 1038034739 8:23677665-23677687 CCTCCGCCTCTCGGGTTCCAGCG No data
Right 1038034745 8:23677696-23677718 GTCTCAGCCTCCGGAGTAGCTGG 0: 236
1: 15450
2: 213193
3: 263342
4: 174056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038034739 Original CRISPR CGCTGGAACCCGAGAGGCGG AGG (reversed) Intergenic
No off target data available for this crispr