ID: 1038035286

View in Genome Browser
Species Human (GRCh38)
Location 8:23682159-23682181
Sequence CTCTCTCTCCTGGACACCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038035282_1038035286 12 Left 1038035282 8:23682124-23682146 CCTCATCAGAAGTGACAGGAAAG 0: 1
1: 0
2: 2
3: 25
4: 294
Right 1038035286 8:23682159-23682181 CTCTCTCTCCTGGACACCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038035286 Original CRISPR CTCTCTCTCCTGGACACCGG AGG Intronic
No off target data available for this crispr