ID: 1038035602

View in Genome Browser
Species Human (GRCh38)
Location 8:23683367-23683389
Sequence GAGAGCACCCAGAACTCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038035602_1038035605 -5 Left 1038035602 8:23683367-23683389 CCGTGAGAGTTCTGGGTGCTCTC No data
Right 1038035605 8:23683385-23683407 CTCTCTCTCTCTGGGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038035602 Original CRISPR GAGAGCACCCAGAACTCTCA CGG (reversed) Intergenic
No off target data available for this crispr