ID: 1038038709

View in Genome Browser
Species Human (GRCh38)
Location 8:23706598-23706620
Sequence TCCCGAAGGCGGATGGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038038696_1038038709 19 Left 1038038696 8:23706556-23706578 CCTTGACCGAGAAGGGGGTGGAG 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1038038709 8:23706598-23706620 TCCCGAAGGCGGATGGGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 104
1038038698_1038038709 13 Left 1038038698 8:23706562-23706584 CCGAGAAGGGGGTGGAGGTGACG 0: 1
1: 0
2: 1
3: 16
4: 225
Right 1038038709 8:23706598-23706620 TCCCGAAGGCGGATGGGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038038709 Original CRISPR TCCCGAAGGCGGATGGGGCG GGG Exonic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
902078462 1:13805338-13805360 ACCCAAAGGAGGATGGGGTGGGG - Intronic
902625178 1:17672193-17672215 TGGGGAAGGCGGCTGGGGCGGGG - Intronic
903605633 1:24573164-24573186 CCCTGAAGGCTGATGGGGCCTGG - Intronic
908850717 1:68373333-68373355 TCCCGCAGGCGGTGCGGGCGGGG - Intergenic
909496587 1:76285908-76285930 TCCAGATGGGGGAGGGGGCGCGG - Intronic
912385560 1:109269607-109269629 GCCCGAAGCCTGAGGGGGCGAGG - Intronic
913318719 1:117574247-117574269 CCCCGAAGGCTGATGGAGCTGGG - Intergenic
915222441 1:154385702-154385724 TCCAGGAAGAGGATGGGGCGTGG + Intergenic
918071608 1:181137432-181137454 TCCCATAGGCGGGTGGGGTGTGG - Intergenic
922718355 1:227888199-227888221 TCCCCAAGGCGGTGGGGGCCAGG + Intergenic
922958590 1:229625911-229625933 TCCCGGAGGCGGCGGCGGCGGGG - Exonic
923329390 1:232908796-232908818 TCCTGAAGGAGGAGGGGCCGTGG + Intergenic
1062894590 10:1093058-1093080 GAAGGAAGGCGGATGGGGCGGGG + Intronic
1063288330 10:4713783-4713805 TCCTGAAGGTGGAAGGGGCAGGG + Intergenic
1064167886 10:13001836-13001858 TCCCGGCGCCGGCTGGGGCGGGG + Intronic
1073049210 10:100656756-100656778 GCCAGAAGGCCGGTGGGGCGGGG - Intergenic
1073544563 10:104337685-104337707 TCCCGAAAGAGGAAGCGGCGGGG + Intronic
1078902154 11:15651297-15651319 TCCCGGAGGCAGACGGGGAGCGG + Intergenic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1084516327 11:69639596-69639618 TCCCGGCGGGGGAGGGGGCGCGG + Intergenic
1091514756 12:1168002-1168024 GCCCAAAGGCTGACGGGGCGCGG - Intronic
1094543971 12:31386631-31386653 TCCCGAGGGGGGATGGGCCCTGG + Exonic
1096818405 12:54216103-54216125 TTCCCCAGCCGGATGGGGCGAGG - Intergenic
1102470076 12:113154802-113154824 TTGTGCAGGCGGATGGGGCGGGG - Intronic
1103024717 12:117564121-117564143 TCCCGAAGGAGGAAGGGAAGAGG + Intronic
1103626660 12:122225569-122225591 TCCCGAGGGCAGAAGGGGCCGGG - Intronic
1105218862 13:18307310-18307332 TCCAGAATCCGGATGGGTCGTGG - Intergenic
1105787346 13:23762633-23762655 TCCCCAAGGAGGAAGGGGCATGG - Intronic
1112023312 13:95390788-95390810 TACAGAAGGCGGAAGGGGAGAGG - Intergenic
1113630600 13:111880443-111880465 TCCTGTAGGCAGATGGAGCGGGG + Intergenic
1113775203 13:112940444-112940466 TCCCGTGGTCGGGTGGGGCGGGG + Intronic
1119455062 14:74748117-74748139 TCCCAATGGCAGGTGGGGCGTGG + Intergenic
1119764878 14:77181966-77181988 TCCCGCACGGGGAGGGGGCGGGG + Intronic
1121342792 14:93115406-93115428 GCCCGCAGGCGGCGGGGGCGTGG - Intronic
1122387210 14:101357245-101357267 CCCCGAAGGCGGTGGGGGTGGGG - Intergenic
1123028935 14:105441436-105441458 GCCGCAAGGCGTATGGGGCGGGG + Intronic
1128345538 15:66850393-66850415 TTCAGAAGGGGGATGGGGCATGG + Intergenic
1129877110 15:78982896-78982918 TCCCCAAAGAGGATGGGGAGAGG + Intronic
1132314472 15:100879968-100879990 TCCAGGTTGCGGATGGGGCGCGG - Exonic
1138529571 16:57627844-57627866 ACCAGAAGGGGGATGGGGCATGG + Intronic
1139531337 16:67544132-67544154 TCCAGAAGGAGGAAGGGGCTGGG - Intronic
1141614360 16:85202233-85202255 TCCAGAAGGCAGTTGGGGCTGGG - Intergenic
1142587000 17:979920-979942 TGGCGAGGGCGGAGGGGGCGTGG - Intergenic
1143020823 17:3916497-3916519 TCCCAAAGATAGATGGGGCGGGG + Exonic
1143783083 17:9239655-9239677 TCCTGAAGGCGGACAAGGCGGGG + Exonic
1146079081 17:29761118-29761140 TCGCGGAGGCGGAGGGCGCGCGG + Intronic
1148122750 17:45222263-45222285 ACCCGGAGGCGGGTCGGGCGCGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149491056 17:57085439-57085461 ACCCGAAGGCGGCGGGGTCGGGG + Intronic
1151854492 17:76711065-76711087 TCCCGGGGCCGGAGGGGGCGGGG - Intergenic
1152308870 17:79537226-79537248 GCCAGAAGCCGGAAGGGGCGAGG - Intergenic
1157867360 18:51197767-51197789 GCCCGAAGGAGGGTGGGGGGTGG - Intronic
1159002432 18:62986396-62986418 TCCTGAAGGACGATGGGGCGTGG + Intergenic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1160515443 18:79476954-79476976 TCCCAAAGGCGGATGGAGTTCGG + Intronic
1160592217 18:79951204-79951226 TCCCGGAGGGGGCTGGGGAGGGG + Intronic
1160864966 19:1252409-1252431 CCCCGAAAGGGGAGGGGGCGGGG + Intronic
1160930597 19:1568016-1568038 GCCCGACGGCGGCGGGGGCGGGG - Exonic
1161558964 19:4960309-4960331 TCTTGAAGGCAGATGGGGTGAGG + Intronic
1162798222 19:13097618-13097640 ACCCGGACGGGGATGGGGCGAGG - Intronic
1163333968 19:16659830-16659852 CCCAGAGGGCGGATAGGGCGGGG + Intronic
1163583878 19:18153762-18153784 TCCGGGAGGCGGGAGGGGCGGGG - Intronic
1163756204 19:19107793-19107815 TCCCGAAGCCGGCTGGGCCTGGG - Intronic
1165742459 19:38211958-38211980 TCCCGCAGGGGGAGGGGGAGAGG - Exonic
1165948466 19:39459116-39459138 TCCCTAAGCGGGAAGGGGCGGGG + Intronic
1166551347 19:43668236-43668258 TCCGGAGGGCTGATGGGGCCGGG - Intronic
1167220352 19:48195165-48195187 CCACGAAGGCGGCTGGGCCGTGG - Exonic
927209141 2:20627997-20628019 TCCCCAAGGCGGGAGGGGCAGGG + Intronic
940261646 2:151786074-151786096 TCCCTAAGGGGGATGGGGTGAGG + Intergenic
944670640 2:201991665-201991687 ACCAGAAGGCAGATGGAGCGCGG + Intergenic
946003053 2:216499022-216499044 TCCCCAAGGCGGAGGGGCGGGGG + Intronic
1172244763 20:33438336-33438358 TCCCAAAGGAGGATGGGTCTTGG + Intronic
1172607281 20:36222509-36222531 TCAGGAAGGCTGATGGGGGGAGG - Intronic
1173279958 20:41618723-41618745 TCCCGCGGGCCGAGGGGGCGGGG + Intergenic
1173686034 20:44924099-44924121 TCCCCAAGGCAGTTGGGGCTTGG + Intronic
1174191696 20:48744939-48744961 TGGTGAAGGCGGATGGGGCAGGG + Intronic
1174736674 20:52972112-52972134 TCCGGGAGGCGGAAGGGGCGGGG - Intergenic
1179881953 21:44296661-44296683 TCCCGCAGGGGGAGGGGCCGGGG - Intronic
1179906871 21:44427132-44427154 CCCCAAAGGCTGACGGGGCGGGG - Intronic
1183149751 22:36028430-36028452 TCCCGGAGGCGAGGGGGGCGCGG - Intergenic
1183323902 22:37181059-37181081 TCCCCAAGGCTGGTGGGACGGGG - Exonic
1184427716 22:44422994-44423016 TCCCTGAGGAGGATGGGGAGGGG - Intergenic
1185273320 22:49938440-49938462 TGGAGAAGGCGGATGGGGCAGGG + Intergenic
951558758 3:23945682-23945704 TCCCCATGGCCGGTGGGGCGGGG + Intronic
953271492 3:41449410-41449432 TCCAGAAGGCAGATGGGCGGTGG + Intronic
965773606 3:172206581-172206603 TCCAGAAGGCGGATGTTGCAAGG + Intronic
972275890 4:37557531-37557553 TTCATAAGGCAGATGGGGCGAGG + Intronic
982157218 4:152535277-152535299 TCCCGAGGGCGGCGGGGCCGGGG - Exonic
982474984 4:155839404-155839426 TCCAGAAGTAGGATGGGGAGGGG + Intronic
1002193475 5:177490543-177490565 TCCCGGAGGCGGGTGTAGCGTGG + Intronic
1003544900 6:7051436-7051458 CCCCGAGGGCGGCTGCGGCGCGG + Intergenic
1006509402 6:34513756-34513778 TGCTGAAGGGGGATGGGGTGGGG - Intronic
1010982283 6:82381900-82381922 TCCAGAAGGAGGATGGGGGTGGG - Intergenic
1016420596 6:143878474-143878496 TCTCAAAGGCGGAAGGGGAGGGG + Intronic
1018461344 6:164002230-164002252 TCCTGAAGGAGGGTAGGGCGTGG + Intergenic
1023124930 7:36946013-36946035 TGCCAAAGGAGGATGGGACGTGG + Intronic
1026909555 7:74084135-74084157 TCCCGGAGGAGGCAGGGGCGCGG - Intronic
1034622079 7:152464040-152464062 CCCGGAAGGCGGTGGGGGCGGGG + Intergenic
1037879784 8:22566917-22566939 TCCCAGAGGGGGATGGGGAGGGG + Intronic
1038038709 8:23706598-23706620 TCCCGAAGGCGGATGGGGCGGGG + Exonic
1045305112 8:100951589-100951611 TCCCGAAGGTGGACGAGGCATGG - Intronic
1052915516 9:33922198-33922220 ACCTGAAGGCAGATGGGGTGGGG + Exonic
1057259995 9:93577690-93577712 TCCCTAAGGAAGATGGGGAGGGG + Intronic
1060966916 9:127716677-127716699 TCCCTAAGGGGAATGGGGCTGGG + Exonic
1061108939 9:128553008-128553030 TGCCGCAGCCGGATGGGGCAGGG - Intronic
1061709616 9:132478625-132478647 TCTCCAAGGCAGATGGGGCCCGG + Intronic
1195387266 X:104324906-104324928 TCCCTCAGGCTGCTGGGGCGGGG - Intergenic