ID: 1038039292

View in Genome Browser
Species Human (GRCh38)
Location 8:23710357-23710379
Sequence AGATGGAGACGGCCGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038039285_1038039292 24 Left 1038039285 8:23710310-23710332 CCCTTACTCAGGAATGGAGACAT No data
Right 1038039292 8:23710357-23710379 AGATGGAGACGGCCGTGCTAGGG No data
1038039286_1038039292 23 Left 1038039286 8:23710311-23710333 CCTTACTCAGGAATGGAGACATC No data
Right 1038039292 8:23710357-23710379 AGATGGAGACGGCCGTGCTAGGG No data
1038039289_1038039292 -7 Left 1038039289 8:23710341-23710363 CCTCTGTTCTTAGGTGAGATGGA No data
Right 1038039292 8:23710357-23710379 AGATGGAGACGGCCGTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038039292 Original CRISPR AGATGGAGACGGCCGTGCTA GGG Intergenic
No off target data available for this crispr