ID: 1038041432

View in Genome Browser
Species Human (GRCh38)
Location 8:23727088-23727110
Sequence GGAGCTCCGCGCAGGCCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038041423_1038041432 0 Left 1038041423 8:23727065-23727087 CCGCCGGCGCCAGGGCGGGTGGT No data
Right 1038041432 8:23727088-23727110 GGAGCTCCGCGCAGGCCGGGGGG No data
1038041425_1038041432 -3 Left 1038041425 8:23727068-23727090 CCGGCGCCAGGGCGGGTGGTGGA No data
Right 1038041432 8:23727088-23727110 GGAGCTCCGCGCAGGCCGGGGGG No data
1038041414_1038041432 24 Left 1038041414 8:23727041-23727063 CCTCGCGCTGTTGACGACGCGGG No data
Right 1038041432 8:23727088-23727110 GGAGCTCCGCGCAGGCCGGGGGG No data
1038041412_1038041432 30 Left 1038041412 8:23727035-23727057 CCGACACCTCGCGCTGTTGACGA No data
Right 1038041432 8:23727088-23727110 GGAGCTCCGCGCAGGCCGGGGGG No data
1038041426_1038041432 -9 Left 1038041426 8:23727074-23727096 CCAGGGCGGGTGGTGGAGCTCCG No data
Right 1038041432 8:23727088-23727110 GGAGCTCCGCGCAGGCCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038041432 Original CRISPR GGAGCTCCGCGCAGGCCGGG GGG Intergenic
No off target data available for this crispr