ID: 1038042135

View in Genome Browser
Species Human (GRCh38)
Location 8:23732476-23732498
Sequence CAGCCAAGACCCACACATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038042135_1038042140 1 Left 1038042135 8:23732476-23732498 CCATGATGTGTGGGTCTTGGCTG No data
Right 1038042140 8:23732500-23732522 AAGACTCAAAGCCTGGGGATTGG No data
1038042135_1038042139 -4 Left 1038042135 8:23732476-23732498 CCATGATGTGTGGGTCTTGGCTG No data
Right 1038042139 8:23732495-23732517 GCTGGAAGACTCAAAGCCTGGGG No data
1038042135_1038042138 -5 Left 1038042135 8:23732476-23732498 CCATGATGTGTGGGTCTTGGCTG No data
Right 1038042138 8:23732494-23732516 GGCTGGAAGACTCAAAGCCTGGG No data
1038042135_1038042137 -6 Left 1038042135 8:23732476-23732498 CCATGATGTGTGGGTCTTGGCTG No data
Right 1038042137 8:23732493-23732515 TGGCTGGAAGACTCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038042135 Original CRISPR CAGCCAAGACCCACACATCA TGG (reversed) Intergenic
No off target data available for this crispr