ID: 1038043768

View in Genome Browser
Species Human (GRCh38)
Location 8:23749020-23749042
Sequence TTAAATACACAAATGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038043761_1038043768 18 Left 1038043761 8:23748979-23749001 CCCAGCCATAAGTGTGCTTATAA No data
Right 1038043768 8:23749020-23749042 TTAAATACACAAATGCAGGAGGG No data
1038043762_1038043768 17 Left 1038043762 8:23748980-23749002 CCAGCCATAAGTGTGCTTATAAG No data
Right 1038043768 8:23749020-23749042 TTAAATACACAAATGCAGGAGGG No data
1038043760_1038043768 26 Left 1038043760 8:23748971-23748993 CCACTGTGCCCAGCCATAAGTGT No data
Right 1038043768 8:23749020-23749042 TTAAATACACAAATGCAGGAGGG No data
1038043763_1038043768 13 Left 1038043763 8:23748984-23749006 CCATAAGTGTGCTTATAAGAGAG No data
Right 1038043768 8:23749020-23749042 TTAAATACACAAATGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038043768 Original CRISPR TTAAATACACAAATGCAGGA GGG Intergenic
No off target data available for this crispr