ID: 1038051053

View in Genome Browser
Species Human (GRCh38)
Location 8:23811881-23811903
Sequence ATTAATACACAGATGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038051050_1038051053 22 Left 1038051050 8:23811836-23811858 CCCAAAATGTCAAAACATTATAA No data
Right 1038051053 8:23811881-23811903 ATTAATACACAGATGTTGGATGG No data
1038051049_1038051053 23 Left 1038051049 8:23811835-23811857 CCCCAAAATGTCAAAACATTATA No data
Right 1038051053 8:23811881-23811903 ATTAATACACAGATGTTGGATGG No data
1038051051_1038051053 21 Left 1038051051 8:23811837-23811859 CCAAAATGTCAAAACATTATAAA No data
Right 1038051053 8:23811881-23811903 ATTAATACACAGATGTTGGATGG No data
1038051048_1038051053 26 Left 1038051048 8:23811832-23811854 CCTCCCCAAAATGTCAAAACATT No data
Right 1038051053 8:23811881-23811903 ATTAATACACAGATGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038051053 Original CRISPR ATTAATACACAGATGTTGGA TGG Intergenic
No off target data available for this crispr