ID: 1038056020

View in Genome Browser
Species Human (GRCh38)
Location 8:23858419-23858441
Sequence AAGTTGGACCATTTTTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038056016_1038056020 3 Left 1038056016 8:23858393-23858415 CCAAGGTTGTTTTGGCATAGTGA No data
Right 1038056020 8:23858419-23858441 AAGTTGGACCATTTTTCTTTGGG No data
1038056014_1038056020 7 Left 1038056014 8:23858389-23858411 CCCACCAAGGTTGTTTTGGCATA No data
Right 1038056020 8:23858419-23858441 AAGTTGGACCATTTTTCTTTGGG No data
1038056015_1038056020 6 Left 1038056015 8:23858390-23858412 CCACCAAGGTTGTTTTGGCATAG No data
Right 1038056020 8:23858419-23858441 AAGTTGGACCATTTTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038056020 Original CRISPR AAGTTGGACCATTTTTCTTT GGG Intergenic
No off target data available for this crispr