ID: 1038056619

View in Genome Browser
Species Human (GRCh38)
Location 8:23864355-23864377
Sequence CCCTCCAAGAAAACAAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038056619_1038056624 -4 Left 1038056619 8:23864355-23864377 CCATGGCTTGTTTTCTTGGAGGG No data
Right 1038056624 8:23864374-23864396 AGGGTGGATTTATGGAGGAATGG No data
1038056619_1038056625 26 Left 1038056619 8:23864355-23864377 CCATGGCTTGTTTTCTTGGAGGG No data
Right 1038056625 8:23864404-23864426 ATTGCACACCTATACTCTCCAGG No data
1038056619_1038056623 -9 Left 1038056619 8:23864355-23864377 CCATGGCTTGTTTTCTTGGAGGG No data
Right 1038056623 8:23864369-23864391 CTTGGAGGGTGGATTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038056619 Original CRISPR CCCTCCAAGAAAACAAGCCA TGG (reversed) Intergenic
No off target data available for this crispr