ID: 1038056624

View in Genome Browser
Species Human (GRCh38)
Location 8:23864374-23864396
Sequence AGGGTGGATTTATGGAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038056619_1038056624 -4 Left 1038056619 8:23864355-23864377 CCATGGCTTGTTTTCTTGGAGGG No data
Right 1038056624 8:23864374-23864396 AGGGTGGATTTATGGAGGAATGG No data
1038056617_1038056624 -3 Left 1038056617 8:23864354-23864376 CCCATGGCTTGTTTTCTTGGAGG No data
Right 1038056624 8:23864374-23864396 AGGGTGGATTTATGGAGGAATGG No data
1038056615_1038056624 1 Left 1038056615 8:23864350-23864372 CCTTCCCATGGCTTGTTTTCTTG No data
Right 1038056624 8:23864374-23864396 AGGGTGGATTTATGGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038056624 Original CRISPR AGGGTGGATTTATGGAGGAA TGG Intergenic
No off target data available for this crispr