ID: 1038056625

View in Genome Browser
Species Human (GRCh38)
Location 8:23864404-23864426
Sequence ATTGCACACCTATACTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038056617_1038056625 27 Left 1038056617 8:23864354-23864376 CCCATGGCTTGTTTTCTTGGAGG No data
Right 1038056625 8:23864404-23864426 ATTGCACACCTATACTCTCCAGG No data
1038056619_1038056625 26 Left 1038056619 8:23864355-23864377 CCATGGCTTGTTTTCTTGGAGGG No data
Right 1038056625 8:23864404-23864426 ATTGCACACCTATACTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038056625 Original CRISPR ATTGCACACCTATACTCTCC AGG Intergenic
No off target data available for this crispr