ID: 1038060513

View in Genome Browser
Species Human (GRCh38)
Location 8:23907257-23907279
Sequence CTCTTCAAGGGGAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038060513_1038060519 -6 Left 1038060513 8:23907257-23907279 CCTTCTACCTTCCCCTTGAAGAG No data
Right 1038060519 8:23907274-23907296 GAAGAGTTCTAAGTAGGTGATGG No data
1038060513_1038060521 5 Left 1038060513 8:23907257-23907279 CCTTCTACCTTCCCCTTGAAGAG No data
Right 1038060521 8:23907285-23907307 AGTAGGTGATGGCACCAGGTTGG No data
1038060513_1038060520 1 Left 1038060513 8:23907257-23907279 CCTTCTACCTTCCCCTTGAAGAG No data
Right 1038060520 8:23907281-23907303 TCTAAGTAGGTGATGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038060513 Original CRISPR CTCTTCAAGGGGAAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr