ID: 1038062965

View in Genome Browser
Species Human (GRCh38)
Location 8:23932432-23932454
Sequence CAAGCATCCTATACCCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038062964_1038062965 -6 Left 1038062964 8:23932415-23932437 CCACTAGGAATGCATTGCAAGCA No data
Right 1038062965 8:23932432-23932454 CAAGCATCCTATACCCAGCATGG No data
1038062962_1038062965 6 Left 1038062962 8:23932403-23932425 CCTCTGAAAGTCCCACTAGGAAT No data
Right 1038062965 8:23932432-23932454 CAAGCATCCTATACCCAGCATGG No data
1038062963_1038062965 -5 Left 1038062963 8:23932414-23932436 CCCACTAGGAATGCATTGCAAGC No data
Right 1038062965 8:23932432-23932454 CAAGCATCCTATACCCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038062965 Original CRISPR CAAGCATCCTATACCCAGCA TGG Intergenic
No off target data available for this crispr