ID: 1038067641

View in Genome Browser
Species Human (GRCh38)
Location 8:23979759-23979781
Sequence GACACTCATATAACTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038067641_1038067642 3 Left 1038067641 8:23979759-23979781 CCAGCTGCAGTTATATGAGTGTC No data
Right 1038067642 8:23979785-23979807 GAGCTAAACATAATCGTCCATGG No data
1038067641_1038067644 25 Left 1038067641 8:23979759-23979781 CCAGCTGCAGTTATATGAGTGTC No data
Right 1038067644 8:23979807-23979829 GCTTTCTTTTGCTGAATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038067641 Original CRISPR GACACTCATATAACTGCAGC TGG (reversed) Intergenic
No off target data available for this crispr