ID: 1038071602

View in Genome Browser
Species Human (GRCh38)
Location 8:24020770-24020792
Sequence CCTTATAAACTGAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038071599_1038071602 10 Left 1038071599 8:24020737-24020759 CCTTTTGCAAGTAAGAAATATGA No data
Right 1038071602 8:24020770-24020792 CCTTATAAACTGAAGTTTGAAGG No data
1038071598_1038071602 15 Left 1038071598 8:24020732-24020754 CCTGTCCTTTTGCAAGTAAGAAA No data
Right 1038071602 8:24020770-24020792 CCTTATAAACTGAAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038071602 Original CRISPR CCTTATAAACTGAAGTTTGA AGG Intergenic
No off target data available for this crispr