ID: 1038072347

View in Genome Browser
Species Human (GRCh38)
Location 8:24031019-24031041
Sequence GTGAGCATTGCTGAGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038072342_1038072347 -5 Left 1038072342 8:24031001-24031023 CCCTTTCTCTGTTCATGGGTGAG No data
Right 1038072347 8:24031019-24031041 GTGAGCATTGCTGAGACTGGGGG No data
1038072343_1038072347 -6 Left 1038072343 8:24031002-24031024 CCTTTCTCTGTTCATGGGTGAGC No data
Right 1038072347 8:24031019-24031041 GTGAGCATTGCTGAGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038072347 Original CRISPR GTGAGCATTGCTGAGACTGG GGG Intergenic
No off target data available for this crispr